GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PRDM1
PR/SET domain 1

Gene
Official SymbolPRDM1
Official Full NamePR/SET domain 1
CGNC ID11462
also known asBlimp-1, PR domain zinc finger protein 1|B-lymphocyte-induced maturation protein 1|PR domain 1|PR domain containing 1, with ZNF domain
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_003641038
PolypeptideXP_003641086
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.46807
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene445340
Ensembl Gene
KEGGgga:445340

Entry 1

GEISHA IdPRDM1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-TGGTACAGCAGCCAGTTCAG-3’
Reverse cDNA Template Primer5’-AATTAACCCTCACTAAAGGTTTCCCTTCTGAGCACGGTC-3’cDNA Template Length743
Complete cDNA Template Probeshow
TGGTACAGCAGCCAGTTCAGAACACATAATGCAACCTAAACCTACCTCAGTGGTGTTGGCTGCCACCGGCGGTGAAGAA
GCCATGAATCTCATTAAAAGCAAGAGGAATGTGACTGGTTACAAAACCCTCCCATACCCACTGAAGAAGCAGAACGGGA
AGATCAAGTACGAATGCAACGTTTGCTCCAAGACCTTTGGCCAGCTCTCCAATCTGAAGGTGCACCTCCGAGTACACAG
CGGAGAGAGACCATTTAAATGCCAGACTTGCAATAAAGGCTTCACACAGCTGGCTCACCTCCAGAAGCACTATCTGGTA
CACACAGGAGAGAAGCCCCACGAGTGTCAGGTTTGTCACAAGCGGTTCAGCAGCACCAGCAATCTCAAAACCCACCTGC
GGCTCCACTCTGGAGAGAAGCCTTACCAGTGCAAGCTGTGCCCAGCCAAATTCACCCAGTTTGTGCACCTGAAGCTGCA
CAAGCGTCTCCACACCCGGGAGCGTCCCCACAAATGCATCCACTGCCACAAGAGCTACATTCACCTCTGCAGCCTCCAG
GTCCACCTGAAGGGCAACTGCCCTGTCGCCCCCGCCTCCGGCCTCTCGATGGAGGACCTGAACCGAATCAACGAGGAGA
TCGAGAAGTTCGACATCAGTGACAATGCCGACAAGTTGGAAGAGGTGGAGGACAATATCGACTTAACGTCCATCGTGGA
GAAGGATATACTGACCGTGCTCAGAAGGGAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 6
Early Endoderm
Early Mesoderm
Headfold
Primitive Streak
 
7-12
stage 7
stage 7
stage 10
stage 10
stage 10
stage 10
Ectoderm
Endoderm
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
Sclerotome
Somatic Mesoderm
Splanchnic Mesoderm
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
 
13-18
stage 13
stage 13
Intermediate Mesoderm
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Splanchnic Mesoderm
extraembryonic mesoderm
 
19-24
stage 19
stage 19
stage 19
stage 19
stage 23
stage 24
stage 24
stage 24
stage 24
stage 24
Aorta
Duodenum
Ear/Otic Placode
Eye
Foregut
Head Mesenchyme
Leg AER
Leg Mesenchyme
Liver
Lung
Mesonephros
Myotome
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Stomach
Ventricles
Wing AER
Wing Mesenchyme
 
25
stage 25
stage 25
stage 25
stage 25
Duodenum
Ear/Otic Placode
Eye
Head Mesenchyme
Leg Ectoderm
Lung
Mesonephros
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Stomach
Wing Mesenchyme
 

Entry 2

GEISHA IdBlimp-1.Ha.2003Data SourcePublication
Complete cDNA Template Probeshow
ATGAAAATGGACATGGAGGATGCTGACATGACCCTGTGGACGGAGGCTGATTTCGAAGAGAAGTGCACGTACATCGTCA
ATGACCACCCGTGGGACCCCAGTGCCGATGGAGGCACCCTCACTCAGGCGGAGGCTTCCTTGCCAAGGAACTTGACTTT
CAAATACGCATCAAACTGCAAAGAGGTCACTGGAGTTATAAGCAAAGAGTACATCCCAAAAGGAACACGCTTTGGACCC
CTGGTAGGAGAGATCTATACCAGCGATACGGTTCCCAAGAATGCGAACAGAAAATACTTTTGGCGGATCTATTCAAGTG
GTGAGCTTCACCACTTCATTGACGGCTTTAATGAGGACAAGAGCAACTGGATGCGTTATGTAAACCCTGGCTACTCAGT
TCAGGAGCAGAACTTGGCAGCCTGTCAGAATGGAATGAACATCTACTTCTACACTATCAAGCCCATCCCTGCCAACCAA
GAGCTGCTTGTGTGGTATTGCCGAGACTTTGCAGAGAGGCTGCACTATCCCTCCTCCAGAGAGCTGACAATGATGAACC
TCACACAAACCCACGTTAATCCAAAGCAGCACAGTGCTGATAAAGATGAGCTCTATCAGAAGAGCGTCCCAAAGAAGGA
GCACAGTGTGAAAGAAATCCTA
CitationHa AS, Riddle RD. cBlimp-1 expression in chick limb bud development. Gene Expr Patterns. 2003 Jun;3(3):297-300.
CopyrightReprinted from Gene Expr Patterns, Volume 3, Issue 3, Alice S. Ha and Robert D. Riddle, cBlimp-1 expression in chick limb bud development, Pages 297-300, Copyright 2003, with permission from Elsevier. Copyright © 2003 Elsevier Science B.V. All rights reserved.
CommentsAuthors state: Whole-mount and section in situ hybridizations using digoxigenin- and fluorescein-labeled antisense RNA probes were performed as previously described ( Adams et al., 2000). Because insufficient information provided to verify exact probe sequence, sequence was obtained from NCBI (Acc# AB278131).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 17
stage 17
stage 17
stage 18
stage 18
Ear/Otic Placcode
Leg Ectoderm
Pharyngeal Arches and Clefts
Wing Ectoderm
 
19-20
stage 19
stage 19
stage 20
stage 20
Ear/Otic Placcode
Eye
Leg AER
Leg Ectoderm
Pharyngeal Arches and Clefts
Telencephalon
Wing AER
Wing Ectoderm
Wing Mesenchyme
 

Entry 3

GEISHA IdPRDM1.Beermann.2010Data SourcePublication
Complete cDNA Template Probeshow
TCATACCAGCACCTAACAGTGCCTTCTCTATCACGGGCGCTGCTGCCAGCATGAAGGACAAGCCATGCAGCCCCACCAG
CGGGTCACCCACAGCTGGTACAGCAGCCAGTTCAGAACACATAATGCAACCTAAACCTACCTCAGTGGTGTTGGCTGCC
ACCGGCGGTGAAGAAGCCATGAATCTCATTAAAAGCAAGAGGAATGTGACTGGTTACAAAACCCTCCCATACCCACTGA
AGA
CitationMary Lou Beermann, Magdalena Ardelt, Mahasweta Girgenrath, Jeffrey Boone Miller. Prdm1 (Blimp-1) and the Expression of Fast and Slow Myosin Heavy Chain Isoforms during Avian Myogenesis In Vitro. PLoS One. 2010; 5(4): e9951.
CopyrightCopyright Beermann et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
CommentsThe probe was amplified by PCR using the following primers: 5_-TCATACCAGCACCTAACAGTGCCT-3_ and 5_-TCTTCAGTGGGTATGGGAGGGTTT-3_ and was extracted from NCBI Acc# XM_003641038.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-23
stage 23
stage 23
Wing Mesenchyme
 

Entry 4

GEISHA IdPrdm1.Zwane.2015Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
AGTGCGTGTCGGGGAGTGAGGGCGCGGGTGCGTGCTGTGCGTGCACGGGTGTGCAGCGCTGGGGTGCGCGGTGCCGGGC
GGATGGCTGGCTTTCCCTTGGACTAACATCCCAAGATGCGTGAGCTGGAGGTGGGGAGCCCGCTCTGTGGGGACACATG
AAGGCTGCTACACGGTGTAGCTCGGACGCTGTGAGTTTCAAGAATCTGGTGAAAGGGAGAGAGTGGACAATGAAAATGG
ACATGGAGGATGCTGACATGACCCTGTGGACGGAGGCTGATTTCGAAGAGAAGTGCACGTACATCGTCAATGACCACCC
GTGGGACCCCAGTGCCGATGGAGGCACCCTCACTCAGGCGGAGGCTTCCTTGCCAAGGAACTTGACTTTCAAATACGCA
TCAAACTGCAAAGAGGTCACTGGAGTTATAAGCAAAGAGTACATCCCAAAAGGAACACGCTTTGGACCCCTGGTAGGAG
AGATCTATACCAGCGATACGGTTCCCAAGAATGCGAACAGAAAATACTTTTGGCGGATCTATTCAAGTGGTGAGCTTCA
CCACTTCATTGACGGATTTAATGAGGACAAGAGCAACTGGATGCGTTATGTAAACCCTGGCTACTCAGTTCAGGAGCAG
AACTTGGCAGCCTGTCAGAATGGAATGAACATCTACTTCTACACTATCAAGCCCATCCCTGCCAACCAAGAGCTGCTTG
TGTGGTATTGCCGAGACTTTGCAGAGAGGCTGCACTATCCCTCCTCCAGAGAGCTGACAATGATGAACCTCACACAAAC
CCACGTTAATCCAAAGCAGCACAGTGCTGATAAAGATGAGCTCTATCAGAAGAGCGTCCCAAAGAAGGAGCACAGTGTG
AAAGAAATCCTGAAAATGGAATCCAGTCCTCCAAAAGGAAAAGACTTCTTCCAAACCAACATTTCACCGGTTACTCCAG
AAAAGGACTTGGATGATTTGCGTAAGAACTATAGCCCAGAGAGGTGTTTCTTCCCTCGAGTTGTCTACCCGATCCGACC
TCACATTCCAGAAGACTATCTGAAAGCTTCCTTAGCATATGGGATGGACAGACCCAGCTACATTACTCACTCACCCATC
CAGTCATCTACTACACCAAGTCCTTCTGGGAGGAGCAGTCCAGACCAAAGTTTAAAAAGTTCAAGTCCTCACAGCAGCC
CAGGGGTCACAGTTTCACCTCTGGCACCGACTTCCCAAGAGCACAGAGAGTCATACTCATACCTGAACGGATCCTATGG
CTCAGAAGGATTGGGTTCTTACCCTGGATACGCCCCCCCTAGCCACCTCCCATCTGCCTTTCTACCATCCTATAACCCC
CACTACCCCAAATTTCTGTTACCTCCGTTTAATATGAGCTGTAATAACCTGAGCGCTTTGAACAATATCAATGGCATCA
ACAATTTCAATCTCTTCCCACGGATGTATCCCCTTTATGGCAACCTGCTCAGTGGAGGTAGCCTTTCCCACCACATGTT
GAACCCCACCACGCTCCCCAGCTCATTGCCCAGCGAAGGAGGCCGTCGATTGCTGCAGCCCGATCATCCAAGAGACTTC
CTCATACCAGCACCTAACAGTGCCTTCTCTATCACGGGCGCTGCTGCCAGCATGAAGGACAAGCCATGCAGCCCCACCA
GCGGGTCACCCACAGCTGGTACAGCAGCCAGTTCAGAACACATAATGCAACCTAAACCTACCTCAGTGGTGTTGGCTGC
CACCGGCGGTGAAGAAGCCATGAATCTCATTAAAAGCAAGAGGAATGTGACTGGTTACAAAACCCTCCCATACCCACTG
AAGAAGCAGAACGGGAAGATCAAGTACGAATGCAACGTTTGCTCCAAGACCTTTGGCCAGCTCTCCAATCTGAAGGTGC
ACCTCCGAGTACACAGCGGAGAGAGACCATTTAAATGCCAGACTTGCAATAAAGGCTTCACACAGCTGGCTCACCTCCA
GAAGCACTATCTGGTACACACAGGAGAGAAGCCCCACGAGTGTCAGGTTTGTCACAAGCGGTTCAGCAGCACCAGCAAT
CTCAAAACCCACCTGCGGCTCCACTCTGGAGAGAAGCCTTACCAGTGCAAGCTGTGCCCAGCCAAATTCACCCAGTTTG
TGCACCTGAAGCTGCACAAGCGTCTCCACACCCGGGAGCGTCCCCACAAATGCATCCACTGCCACAAGAGCTACATTCA
CCTCTGCAGCCTCCAGGTCCACCTGAAGGGCAACTGCCCTGTCGCCCCCGCCTCCGGCCTCTCGATGGAGGACCTGAAC
CGAATCAACGAGGAGATCGAGAAGTTCGACATCAGTGACAATGCCGACAAGTTGGAAGAGGTGGAGGACAATATCGACT
TAACGTCCATCGTGGAGAAGGATATACTGACCGTGCTCAGAAGGGAAATGGAAGGAGCTAATCTCAAAGTATCTTTACA
GAGGAACCTGGGAAACGGACTTATCTCCTCAGGATGCAACCTTTACGAGTCTTCAGATATGTCAATTATGAAGTTGCCT
CACAGTCACCCGCTACCTCTGTTACCTGTAAAGGTCAAGCAAGAAACAGTTGAACCAATGGACCCTTAAGACTTTTTGG
CAAAGTGATTTTTTTATTTATGACTTGGCAAGTCAGGGTGCCTGTAGCAGTTGCTTGTACATAGTTTCAATGCTGCAAA
GCAATCTTGGCTTACAGTAGTTTCCCTACGCTCTCCAGCTGAAAGAAGGAACTCCAAAGTTACTGTTTTCTCAGGGCAT
AAAAAGAGGCAAAGGACTGCGTGTTGCCTCGCCAGTTACTAAAAGACAATCATCTATCCATAATTATTTTTTCAATGAT
AGTACTTCATAATTTATTATGCAATTTATCATTCTAAAAGCAATAATTAGAAAAATGTTTACAATGACTGGGAAATTCA
TTGTAATTTTTACTTTAAGTGTTTTTATTTTTTGTTTTATGGCCATTCTTCATTGAGTTTTTTTTCTGCACATCTGTTT
TAAGAACCTAAGATTGGGGTTTCAGTAACCATGTTTTATGTACCAATGTCTTTTAAACAAATGTGTTTTTTTCTATTGC
CAAAGTTGGACATTGACATACAGAATCCTAGATCAGTCAGACTGAAAAAAATGCTGGGTACTTTTATGTGCAAATCACC
CCATTGGGATCGAAAAGGAGAAGAAAAAAAAAGAAAAGGTAGCAGCAAGCAGAGAAGAAACTGCTGCCCCGGCCTCTCT
GAGGGCAGGAGAGGTTCTTCTACCTGCAGCTCTACCCAGAACAGATGTGACACAGCAAACACCTGCATGGACGATACCG
TAGGTTTTTAGAGAACAGCTATAGGCCCACACCTTGTCACATAACTTTATGACCAAAGGAACGCATCAGCTTAAAGTGG
CTCTTCCAAAATAATATATCACTTACATGCTTTTGTTTCCAACAACGGTTTAAAAGCAAACACACCAATATTCTTAATA
TTCTGCCTCAAGGGAGATTTTCGGCAGAATTCTTTCTTTTCTCCCTCTTTTTCTTGTTTTGTTTGTTTTTGGCCAGAGC
CTTCCAAGGATACAAAAAACAGTCAGACTCCCTGAGAAATAAGGGGTTTGGTCTTACATGTGTTTTTCTCACCCGCTTT
GCCTGGGTGTAGAAGTGGGGAACAAAGTCCTTTTCTGGCACATACATATTTTTTCTTTCCTTCCTGTACAACTCAGATT
TTTCTCAGTATTTGTGTTTGTACATTTTGTGGTTAATTTAATTAAAGAAGAAAAGGGCATTGCAAAGTTGTTGAACAAC
AATTACCTCAGTGCTTGTGTCCAGTGGTGCAGACAATGCTGTTTTATCTAAATGCTTTGCTACTTTAGAGAAGAAACCA
AAATGTGCACAGGGAAAGATAGAATGCACGTCCTTTATCTTTTTGTTTTGCTAAGCCCAAAGATGATATGGTGACATTT
GAGGTGTAGCAAAGAGTACATGTATATTTATAGATATATTTATACCACTATACTATATATGTATATGTATATATATTTA
TACCACTTAAGTTGTGAGCCAAACCATGTAATAAAACCTATTTTTCATCTAAGCGTGAAAATCAACTGTTATCCAGTTT
TGCATATTACCAATGACCTCAAAACCAAAAGGTTGTACAAAGGCATTTATCGCTTGCAAGTACACATGCAGGGCTGTCT
TTGCAGGGCCCGAACTTGCAAACGCCTGATGTGAAAAACGTCACTCACATGGGGAGTCTGGGCAAAGTCAGGGGGAGGA
ACCGTGTCTGCAGGACTGGGGTCCTCAGTGCCCTGCTCTCCTGGCAGTGTGTACTGGGGGGAAAAGAGGCGGGTGGGCA
GTGAACGAGCAACCAGAAAACTTAACCAAAAGAACCCAAAAAGAAGCCAAATACTACGCATGCATGGTGTGAGTGCAGA
GCACAGTGAAGGGTAGGCTGAAAGTCAGTGGGGGCGAGCTGTAGTGAGCCCCCCAGTCTCATTATATCCTGCCATTAAC
AAGTTGCATCATCAACTCGCATCAATTTCAGTAGCATTAGCACAGTCTTCCCCTCCAGGTGCATCTTTTTGTCTGTTTC
TATTACAAATTGTAAGGTCTCCCACTTCATCAATCCAGGATTTGGTGATATTTTTTTCCCTGCAGAACTTTATTTTAAT
GCCTTTGGTTCAACAATCCCAACATACACACAGCTTTTGAAGGACTACAGTTCATTACATTTCCACTCCTGCAACTTGT
GAGGCTGACATCTTTTAAATGTAGCAATAGTTCATAAATATAGTACGTACTTGTAGGATAAACCAAAGTATCATTACTC
TGTCACTGGACACTCACTTTTCCTATATTTGCCTGTAGTGCTTTCTTGTATTTGATACAAATTTTACAAGAATTTATAT
GCATCAGCTTTAAGAATTGTTACTTCTCTTTACTGTTTCCCCCTTCCCTTAGAAGTTTTACATGTGAATGTAGCAACAA
TCAACAGTGTTTTGGGGTTTGTTTTTTTTTTTTTTTTTTTTTTTTGTCTCTCTTAAGAAAGACTCTGACCAAAGTTAAC
AGGCTTTTTACTTTGCTAGAACAACAAACTATCATATGTTTACGTATTGGTTTACATCATTATTTATGTGCAAATTGTC
AAATGTAAATTAAATATAAGTGTTCATTGCTTTA
CitationZwane TB, Nikitina NV. Spatiotemporal expression analysis of Prdm1 and Prdm1 binding partners in early chick embryo. Gene Expr Patterns. 2015 Jan;17(1):56-68. Epub 2015 Feb 17. DOI: 10.1016/j.gep.2014.12.003.
CopyrightCopyright © 2014 Elsevier B.V.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (acc # XM_004940353.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Blood Islands
Ectoderm
neural plate border; preplacodal region
7-10
stage 7
stage 7
stage 7
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 9
stage 10
stage 10
stage 10
stage 10
stage 10
Anterior Intestinal Portal
Blood Islands
Ear/Otic Placode
Ectoderm
Foregut
Headfold
Neural Crest
Neural Plate/Tube
Neural Plate Border; Head Ectoderm
head ectoderm
neural plate border
neural plate border; head ectoderm
stage 10+
stage 8+
stage 8+; double ISH, Prdm1 in purple, Snail2 in brown.
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.46807

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona