GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PRDM14
PR/SET domain 14

Gene
Official SymbolPRDM14
Official Full NamePR/SET domain 14
CGNC ID64389
also known asPR domain zinc finger protein 14|PR domain containing 14
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003640840
PolypeptideXP_003640888
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100858709
Ensembl Gene
KEGGgga:100858709
GEISHA IdPRDM14.Okuzaki.2019Data SourcePublication
Complete cDNA Template Probeshow
ATGGCGCTGGCCCTGGCCGGCGAGCCGGGCCCCGCCACGGACGCCACGGACGCGCTCGGGCTGAGCCCCGCCGGGCTCG
CCGCCTACTACCCGCCCTTCCTGCCCCCGGCGCAGTACTTGGAGGCGCCCCCCGACTTCTTCCAGCCCCTGGGCCGCCT
GCTGCCCCCCTCCCCGCCGCTGCCCCCCTTCGGCATCCCCGCGTTCCTCAGCCTCCCGCCGCCCCCCTCGGCCCCGCCG
CCGCTCGCCCAGGCTCCGGCGGACGCCCCGCAGCGGGCGGCCCGGCCCGGGGGAGGCTGCGAGACGGCGGGGCAGAGCC
GCAGGTTCCACTTCAGTGAGGAGGAGCTGAACGCGGTGCTGTACGGGGCGCTTCGTAGCCCTCAGCTGCCCGGCGGGCT
GCACGCCATCTCGGGGCTCCGCGTGCCCCCCGCCAGCCCGGGTGCCGCTCGCTCCCCACCGGCTCCGCCGCCCGACGGG
GACGCGCTGCAGCTGCCCGAAGGGCTGGCCGTGCTGCGCGTGGCCTACGGGGACGTTTGGCACCTCGGGGTGTTCTGCA
CCGCCCCCATCCCCAAAGGAGTCCGCTTCGGCCCGTTCCAAGGCAAAGTGGTCAACACCACCGAGATCAAGACTTACGA
CGACAACTCGCTGATGTGGGAGGTCTTCGAATACGGGCAGCTGAGCCACTTCATCGACGGGAAGGGCACAGCCGGCAAC
TGGATGTCTCTGGTGAACTGCGCCCGCTTCCCCGAGGAGCAGAACCTGACGGCGCTGCAGTGCCAGGGGCAGATCTTTT
ACGAGAGCTGCCGGGAGATCGCGCCCAAGGAGGAGCTGCTGGTGTGGTACGGGGACTGCTACGTGCAGTTCCTGGGCAT
CCCCATCTGCCTGAAGGGCATGCCGGAGGCGGGGCGGCCCCCGCAGCACCCCGAAGGTGAGAACGCGGCGAGCTTCAAG
TGCGAGCGCTGCGGGAAGGTGTTCGCCTACCGCTACTACCGCGACAAACACCTCAAGTACACGCGCTGCGTGGACCGGG
GCGACAGGAAATTCCCCTGCCACCTCTGCAGCCGCTCCTTCGAGAAGAGGGACCGGCTGCGCATCCACGTGCTGCACGT
CCACGAGAAGCACAGACCCCACAAGTGCTCGGTGTGCGGGAAGAGCTTCTCGCAGTCCTCCAGCCTGAACAAACACATG
CGGGTTCACTCCGGGGAGCGCCCCTACAAATGCGTCTACTGCAATAAGGCGTTCACAGCCTCCAGCATCCTGCGCACGC
ACATCCGCCAGCACTCGGGAGAGAAGCCCTTCAAGTGCAAGCACTGCGGCAAAGCCTTCGCCTCGCACGCGGCACACGA
CAGCCACATGCGGCGCACGCACAGCAAGGACAAGGGCAGCACCTGTGCAGTGTGTGGCCAGCACTTTCCAGAGCTGGAG
GACTACCGCTTCCACATGAACGTCCACGCTGCTGCT
CitationYuya Okuzaki, Hidenori Kaneoka, Takayuki Suzuki, Yota Hagihara, Yuki Nakayama, Seitaro Murakami, Yusuke Murase, Atsushi Kuroiwa, Shinji Iijima, Ken-Ichi Nishijima. PRDM14 and BLIMP1 Control the Development of Chicken Primordial Germ Cells. Dev Biol. 2019 Nov 1;455(1):32-41. Epub 2019 Jul 2. DOI: 10.1016/j.ydbio.2019.06.018.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information provided in the publication as described in Okuzaki et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage X
Hypoblast
 
4-6
stage 4
Germinal Crescent
Neural Plate/Tube
 
13-17
stage 17
Neural Crest
Neural Plate/Tube
 
all
 
  

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona