GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PTCH2
patched 2

Gene
Official SymbolPTCH2
Official Full Namepatched 2
CGNC ID14936
also known asprotein patched homolog 2|patched homolog 2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_422426
PolypeptideXP_422426
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.935
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene374187
Ensembl GeneENSGALG00000010133
KEGGgga:374187

Entry 1

GEISHA IdPTC2.Aglyamova.2007Data SourcePublication
Complete cDNA Template Probeshow
NACCCCGGCGTGGCCACCAGCACTCAGATCCCCACCACCGTGCAGGCCTTCACCCAGTGCGACCCCTCGGGCCACCACA
TCGTCACCGTCCTGCCACCCACCTCCCAGGTGTGCACCTCGCCCGCCGTGCTGCTGCCGCCTGCCGACCCGTTGGGCTC
GCAGGTCTTCACCCCCTCCAGCTCCACGCGGGACCTGCTGGCCCAGCTGGATGAGGCCAAAGGCGGGCGCGAGTGCGTG
CCGCTGCCCTTGTGCCGCTGGAGCCTCTCCGACTTTGCCCGTGAGAAGTATGCCCCACTCCTGCTGCGGACCCAGACCA
AGGTGGTGGTGGTGGTCCTCTTCTTGGCGCTGTTGGGACTGAGCCTCTACGGCACCACCATGGTGCATGACGGGCTCTA
CCTGACAGACATTGTGCCGCGGGACACCAAGGCTCACGCCTTCATCTCAGCCCAGTTCAAGTACTTCTCCTTCTACAAC
ATGTTCATTGTCACCAAGGGTGGCTTCCACTACCCGGGTGCCCAGGCCGCCCTGCTCAGCCTGCACCAGGCCTTCAGCA
CTGTCAAGTATGTGGTGCGTGAGGGCAACCATGACCTGCCCAAGATGTGGCTCCACTACTTCCAGGACTGGCTGCGAGG
GCTCCAGGCCACCTTTGACAGAGACTGGCAAGCCGGCCGCATCACCCATGATAGCTACCGCAACGGCTCCGAGGACGGG
GCACTGGCCTACAAGCTCCTCATCCAGACTGGCAACAAGAAGGAGCCTTTCAACTTCAACCAGCTGACCACACGGCGGT
TGGTGGATGAGAATGGCATCATCCCCCCAGACACCTTCTACATCTGCCTGACGGTGTGGGCCAGCAACGACCCCCTGGG
CTTCGCTGCCTCCCAGGCCAACTTCTACCCGCCGCCGCCTGAGTGGATCCATGACAAGTACGACACTACGGGCGAGAAC
CTGCGAATCCCGGCAGCCCAGCCGCTGGAGTTCGCCCAGTTCCCCTTCTACCTGAGCGGGCTGCGTCGCACAGCCGACT
TCGTGGAGGCAATTGAGAGCGTGCGGGCCATCTGCCAGGAGGCGGCCCAGCGCCATGGGGTGCTGAGCTACCCCAGCGG
CTACCCCTTCCTCTTCTGGGAGCAATACATCGGCCTGCGCCACTGGTTCCTGTTGGCCATCAGCATCTTGCTGGCCTGC
ACCTTCCTCGTCTGCGCCCTGCTGCTGCTCAACCCCTGGACGGCCGGTATCATCGTCTCTATCCTGGCCATGATGGCGG
TGGAACTGTTTGGCATTATGGGGCTGATGGGCATCAAGCTGAGTGCCATCCCTGTGGTCATCCTCATCGCTTCAGTTGG
CATCGGCGTGGAGTTCACTGTCCACGTGGCCCTGGTGGTGAAGCCATACAAAGACAGCCATGAGGTCCAGGGAAAGAAG
GAGCAGCCCGTCCCCCAGCCTGCAGCCTCGTTGCCTTTTGGGGAGCCGTGCCCCACAGTGCTCAGAGACTACCCACACC
CCACGGCATTGCCTCGGCCAGGTCAGCCCTGCTCCTCCAGCGCCTGGCCAGCCTCTCGGGCCCCCCTGCCAGCCTACAG
CACCCACCTGCAGGGCCCCGCCGGCAGCTACACCACAGTCACAGCCACCGCTTCGGTGACGGTTGCCCTGCACCCCACG
CTGCCTGGCTCCTACCCCAGCTTTGGCACCGAGACAGACAGCCTGGAGGAGCCCAGCGCTGTGCCTGACTCCTTTGAGA
TGCAAAGCCTGGGACGCCACGGGGCAGGCACCCGGCGCTAG
CitationAglyamova GV, Agarwala S. Gene expression analysis of the hedgehog signaling cascade in the chick midbrain and spinal cord. Dev Dyn. 2007 May;236(5):1363-73
CopyrightCopyright © 2007 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_422426).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Head Process
Hensen's Node
Notochord
 
7-12
stage 10
Neural Plate/Tube
Somites
 
13-18
stage 17
Hindbrain
Isthmus/MHB
Midbrain
 
25-26
stage 26
Hindbrain
Isthmus/MHB
Midbrain
 

Entry 2

GEISHA IdPTC2.Pearse.2001Data SourcePublication
Complete cDNA Template Probeshow
CTTGGCGCTGTTGGGACTGAGCCTCTACGGCACCACCATGGTGCATGACGGGCTCTACCTGACAGACATTGTGCCGCGG
GACACCAAGGCTCACGCCTTCATCTCAGCCCAGTTCAAGTACTTCTCCTTCTACAACATGTTCATTGTCACCAAGGGTG
GCTTCCACTACCCGGGTGCCCAGGCCGCCCTGCTCAGCCTGCACCAGGCCTTCAGCACTGTCAAGTATGTGGTGCGTGA
GGGCAACCATGACCTGCCCAAGATGTGGCTCCACTACTTCCAGGACTGGCTGCGAGGGCTCCAGGCCACCTTTGACAGA
GACTGGCAAGCCGGCCGCATCACCCATGATAGCTACCGCAACGGCTCCGAGGACGGGGCACTGGCCTACAAGCTCCTCA
TCCAGACTGGCAACAAGAAGGAGCCTTTCAACTTCAACCAGCTGACCACACGGCGGTTGGTGGATGAGAATGGCATCAT
CCCCCCAGACACCTTCTACATCTGCCTGACGGTGTGGGCCAGCAACGACCCCCTGGGCTTCGCTGCCTCCCAGGCCAAC
TTCTACCCGCCGCCGCCTGAGTGGATCCATGACAAGTACGACACTACGGGCGAGAACCTGCGAATCCCGGCAGCCCAGC
CGCTGGAGTTCGCCCAGTTCCCCTTCTACCTGAGCGGGCTGCGTCGCACAGCCGACTTCGTGGAGGCAATTGAGAGCGT
GCGGGCCATCTGCCAGGAGGCGGCCCAGCGCCATGGGGTGCTGAGCTACCCCAGCGGCTACCCCTTCCTCTTCTGGGAG
CAATACATCGGCCTGCGCCACTGGTTCCTGTTGGCCATCAGCATCTTGCTGGCCTGCACCTTCCTCGTCTGCGCCCTGC
TGCTGCTCAACCCCTGGACGGCCGGTATCATCGTCTCTATCCTGGCCATGATGGCGGTGGAACTGTTTGGCATTATGGG
GCTGATGGGCATCAAGCTGAGTGCCATCCCTGTGGTCATCCTCATCGCTTCAGTTGGCATCGGCGTGGAGTTCACTGTC
CACGTGGCCCTGGTGGTGAAGCCATACAAAGACAGCCATGAGGTCCAGGGAAAGAAGGAGCAGCCCGTCCCCCAGCCTG
CAGCCTCGTTGCCTTTTGGGGAGCCGTGCCCCACAGTGCTCAGAGACTACCCACACCCCACGGCATTGCCTCGGCCAGG
TCAGCCCTGCTCCTCCAGCGCCTGGCCAGCCTCTCGGGCCCCCCTGCCAGCCTACAGCACCCACCTGCAGGGCCCCGCC
GGCAGCTACACCACAGTCACAGCCACCGCTTCGGTGACGGTTGCCCTGCACCCCACGCTGCCTGGCTCCTACCCCAGCT
TTGGCACCGAGACAGACAGCCTGGAGGAGCCCAGCGCTGTGCCTGACTCCTTTGAGATGCAAAGCCTGGGACGCCACGG
GGCAGGCACCCGGC
CitationPearse RV, Vogan KJ, Tabin CJ. Ptc1 and Ptc2 transcripts provide distinct readouts of Hedgehog signaling activity during chick embryogenesis. Dev Biol. 2001 Nov 1;239(1):15-29.
CopyrightReprinted with permission from Elsevier. Copyright © 2001 Elsevier B.V. All rights reserved.
CommentsAccording to the authors, "To generate an antisense Ptc2 probe, a 1.4-kb fragment of Ptc2 coding sequence (nt 339-1774 of the published sequence) was amplified by PCR from a pBluescript clone using M13 forward and reverse primers. A Dig-labeled cRNA probe was then transcribed from the resulting fragment by using T3 RNA polymerase." The sequence below was obtained from NCBI (XM_422426) using the information provided.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
stage 5
Early Embryo
Hensen's Node
Lateral Plate Mesoderm
Primitive Streak
Early Axial Midline
FIG. 3. Comparison of Shh, Ptc1, and Ptc2 expression at stage HH5+.
7-12
stage 8
Early Embryo
Hensen's Node
Early Axial Midline
13-18
stage 15
Neural Plate/Tube
Somites
 
19-24
stage 19
stage 20
stage 21
stage 22
stage 22
stage 22
stage 23
stage 23
stage 23
stage 24
stage 24
Endoderm
Gut
Leg AER
Limb Buds
Neural Plate/Tube
Pharyngeal Arches and Clefts
Somites
Wing AER
Wing Mesenchyme
 
25-30
stage 25
stage 25
stage 27
stage 30
stage 30
Feathers/Scutae
Leg Bones
Wing Bones
FIG. 2. Developmental overview of chick Ptc2 expression, showing whole-mount and section in situ hybridizations with probes directed against Ptc2, Ptc1, or Shh.
FIG. 4. Comparison of Shh, Ptc1, and Ptc2 expression during early limb bud development.

Entry 3

GEISHA IdPtc2.Scherz.2007Data SourcePublication
Complete cDNA Template Probeshow
CCCCGCCATGCCGGCCGAGCCCCCCCGCTCCGCTCCTCCGCGAGCCGCCGCCGCCGCCCTCCGCAAAGCGCTGCCCGAG
GGCCGCGGGGCCCCGCTGTGGCTGCGGGCCCGCTTCCAGGCGCTGCTCTTCGCGCTGGGCTGCCGGATCCAGCGGCACT
GCGGGAAGGTGCTGTTCGTGGGGCTGCTGCTGTTCGGGGCGCTGGCCGTGGGGCTGCGGGTGGCCTCCGTCGAGACGGA
CATCGAGCACCTCTGGGTGGAAGCGGGCAGCCGGGTCAGCCAGGAGCTCCGCTACACGAAGGAGAAGCTGGGCGAGGAG
TCCGTCTACACGTCCCAAATGCTGATCCAGACCCCGAAACGCGAAGGGGAGAACATCCTGACGCAGGAGGCCCTGCAGC
TCCACCTCGAGGCGGCCCTGGCTGCCAGCAAAGTGCAAGTCTCGCTGTACGGAAAATCGTGGGATTTGAACAAGATCTG
CTACAAGTCAGGCGTCCCCATCATTGAGAATGGAATGATCGAGAGGATGATCGAGAAGCTGTTCCCCTGTGTGATCCTG
ACGCCGCTGGACTGCTTCTGGGAAGGGGCCAAGCTGCAGGGAGGCTCAGCCTACCTCCCGGGCCGTCCTGATATCCAGT
GGAGCAATTTGGACCCTTTGCAGCTGATGGAGGAGCTGGGGCAGTTCACATCCCTAGAAGGCTTCAAGGAGCTGCTGGA
TAAGGCTGAGGTGGGGCAGGCTTATATGGAGCGGCCCTGCCTGGACCCCCGGGACCCCCATTGCCCCTCCAGTGCCCCC
AACAAGCAGAGCCAGCAGAGCCCCGACATCCCGGCGGAGCTCTCTGGGGGCTGCCATGGGTTCTCCAGGAAGTTCATGC
GCTGGCAGGAGGAGCTGATTTTAGGCGGCACAACCAAAGACTCCCAGGGCAAGCTGCTAAGTGCTGAGGCCCTGCAGAC
AATGTTCCTTCTCATGAGCCCCCGGCAGCTGTATGAGCACTTCAAGGATGACTACGAGATCCATGACATCAGCTGGAGT
GAGGAGAAGGCAGGTGCTATCCTGGAGGCCTGGCAGAGGAAATTTGTGGAGCTGGCACAGGACTCCATCCCACCCAATG
CCACGCAGAACATCCATGCCTTCTCCACCACCACGCTCAACGACATCATGAAGTCCTTCTCTGACGTCAGTGCCATCCG
AGTGGCTGGGGGATACCTCCTCATGCTGGCCTATGCCTGTGTCACCATGCTGCGCTGGGACTGCTCCAAGTCACAGGGT
GCTGTGGGCCTGGCCGGGGTCCTGCTGGTGGCCCTCTCTGTGGCCTCTGGCTTAGGGCTCTGCTCACTGCTCGGGATCT
CCTTCAATGCAGCCACCACGCAGGTGCTGCCCTTCCTGGCCCTCGGCATTGGTGTGGATGACATGTTCCTCCTGGCTCA
TGCCTTCACCGAGACCAGCCAGCACATCCCCTTCAAGGAGCGGACAGGAGAGTGCCTACGGCGCACGGGGACCAGCGTG
GCTCTCACCTCCGTCAGCAACATGATTGCCTTCTTCATGGCTGCCCTGGTGCCCATCCCCGCCCTGCGTGCCTTCTCAC
TCCAGGCAGCAGTGGTGGTGGTGTTCAACTTCGCCATGGTGCTGTTCATCTTCCCTGCCATACTGAGCCTGGACCTGTA
CCGGCGGGAGAAGCGTCGCCTCGACATCCTCTGCTGCTTCTACAGCCCTTGCTCCTCACGGGTCATCCAGATCCAACCC
CAGGAGTTGGCCGATGCCAACGACAACCATGCCTCCACCGTCCCCTACGGCCACCCCGGCGTGGCCACCAGCACTCAGA
TCACCACCACCGTGCAGGCCTTCACCCAGTGCGACCCCTCGGGCCACCACATCGTCACCGTCCTGCCACCCACCTCCCA
GGTGTGCACCTCGCCCGCCGTGCTGCTGCCGCCTGCCGACCCGTTGGGCTCGCAGGTCTTCACCCCCTCCAGCTCCACG
CGGGACCTGCTGGCCCAGCTGGATGAGGCCAAAGGCGGGCGCGAGTGCGTGCCGCTGCCCTTGTGCCGCTGGAGCCTCT
CCGACTTTGCCCGTGAGAAGTATGCCCCACTCCTGCTGCAGACCCAGACCAAGGTGGTGGTGGTGGTCCTCTTCTTGGC
GCTGTTGGGACTGAGCCTCTACGGCACCACCATGGTGCATGACGGGCTCTACCTGACAGACATTGTGCCGCGGGACACC
AAGGCTCACGCCTTCATCTCAGCCCAGTTCAAGTACTTCTCCTTCTACAACATGTTCATTGTCACCAAGGGTGGCTTCC
ACTACCCGGGTGCCCAGGCCGCCCTGCTCAGCCTGCACCAGGCCTTCAGCACTGTCAAGTATGTGGTGCGTGAGGGCAA
CCATGACCTGCCCAAGATGTGGCTCCACTACTTCCAGGACTGGCTGCGAGGGCTCCAGGCCACCTTTGACAGAGACTGG
CAAGCCGGCCGCATCACCCATGATAGCTACCGCAACGGCTCCGAGGACGGGGCACTGGCCTACAAGCTCCTCATCCAGA
CTGGCAACAAGAAGGAGCCTTTCAACTTCAACCAGCTGACCACACGGCGGTTGGTGGATGAGAATGGCATCATCCCCCC
AGACACCTTCTACATCTGCCTGACGGTGTGGGCCAGCAACGACCCCCTGGGCTTCGCTGCCTCCCAGGCCAACTTCTAC
CCGCCGCCGCCTGAGTGGATCCATGACAAGTACGACACTACGGGCGAGAACCTGCGAAGTGA
CitationScherz PJ, McGlinn E, Nissim S, Tabin CJ. Extended exposure to Sonic hedgehog is required for patterning the posterior digits of the vertebrate limb.Dev Biol. 2007 Aug 15;308(2):343-54. Epub 2007 May 31.
CopyrightReprinted with permission from Elsevier. Copyright 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # AF409095.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
stage 24
stage 24
Leg
 

Entry 4

GEISHA IdPTCH2.UAlinearData SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
NACCCCGGCGTGGCCACCAGCACTCAGATCCCCACCACCGTGCAGGCCTTCACCCAGTGCGACCCCTCGGGCCACCACA
TCGTCACCGTCCTGCCACCCACCTCCCAGGTGTGCACCTCGCCCGCCGTGCTGCTGCCGCCTGCCGACCCGTTGGGCTC
GCAGGTCTTCACCCCCTCCAGCTCCACGCGGGACCTGCTGGCCCAGCTGGATGAGGCCAAAGGCGGGCGCGAGTGCGTG
CCGCTGCCCTTGTGCCGCTGGAGCCTCTCCGACTTTGCCCGTGAGAAGTATGCCCCACTCCTGCTGCGGACCCAGACCA
AGGTGGTGGTGGTGGTCCTCTTCTTGGCGCTGTTGGGACTGAGCCTCTACGGCACCACCATGGTGCATGACGGGCTCTA
CCTGACAGACATTGTGCCGCGGGACACCAAGGCTCACGCCTTCATCTCAGCCCAGTTCAAGTACTTCTCCTTCTACAAC
ATGTTCATTGTCACCAAGGGTGGCTTCCACTACCCGGGTGCCCAGGCCGCCCTGCTCAGCCTGCACCAGGCCTTCAGCA
CTGTCAAGTATGTGGTGCGTGAGGGCAACCATGACCTGCCCAAGATGTGGCTCCACTACTTCCAGGACTGGCTGCGAGG
GCTCCAGGCCACCTTTGACAGAGACTGGCAAGCCGGCCGCATCACCCATGATAGCTACCGCAACGGCTCCGAGGACGGG
GCACTGGCCTACAAGCTCCTCATCCAGACTGGCAACAAGAAGGAGCCTTTCAACTTCAACCAGCTGACCACACGGCGGT
TGGTGGATGAGAATGGCATCATCCCCCCAGACACCTTCTACATCTGCCTGACGGTGTGGGCCAGCAACGACCCCCTGGG
CTTCGCTGCCTCCCAGGCCAACTTCTACCCGCCGCCGCCTGAGTGGATCCATGACAAGTACGACACTACGGGCGAGAAC
CTGCGAATCCCGGCAGCCCAGCCGCTGGAGTTCGCCCAGTTCCCCTTCTACCTGAGCGGGCTGCGTCGCACAGCCGACT
TCGTGGAGGCAATTGAGAGCGTGCGGGCCATCTGCCAGGAGGCGGCCCAGCGCCATGGGGTGCTGAGCTACCCCAGCGG
CTACCCCTTCCTCTTCTGGGAGCAATACATCGGCCTGCGCCACTGGTTCCTGTTGGCCATCAGCATCTTGCTGGCCTGC
ACCTTCCTCGTCTGCGCCCTGCTGCTGCTCAACCCCTGGACGGCCGGTATCATCGTCTCTATCCTGGCCATGATGGCGG
TGGAACTGTTTGGCATTATGGGGCTGATGGGCATCAAGCTGAGTGCCATCCCTGTGGTCATCCTCATCGCTTCAGTTGG
CATCGGCGTGGAGTTCACTGTCCACGTGGCCCTGGTGGTGAAGCCATACAAAGACAGCCATGAGGTCCAGGGAAAGAAG
GAGCAGCCCGTCCCCCAGCCTGCAGCCTCGTTGCCTTTTGGGGAGCCGTGCCCCACAGTGCTCAGAGACTACCCACACC
CCACGGCATTGCCTCGGCCAGGTCAGCCCTGCTCCTCCAGCGCCTGGCCAGCCTCTCGGGCCCCCCTGCCAGCCTACAG
CACCCACCTGCAGGGCCCCGCCGGCAGCTACACCACAGTCACAGCCACCGCTTCGGTGACGGTTGCCCTGCACCCCACG
CTGCCTGGCTCCTACCCCAGCTTTGGCACCGAGACAGACAGCCTGGAGGAGCCCAGCGCTGTGCCTGACTCCTTTGAGA
TGCAAAGCCTGGGACGCCACGGGGCAGGCACCCGGCGCTAG
CommentsInsufficient information provided to verify exact sequence used to synthesize probe. Sequence above was obtained from NCBI (XM_422426).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Area Pellucida
Head Process
Hensen's Node
Lateral Plate Mesoderm
Mesoderm
Primitive Streak
 
7-12
stage 7
stage 8
stage 9
stage 10
stage 11
Anterior Intestinal Portal
Blood Vessels
Endoderm
Hensen's Node
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Primitive Streak
Somites
 
13-18
stage 14
stage 15
Blood Vessels
Gut
Lateral Plate Mesoderm
Notochord
Oral Pharynx
Pharyngeal Arches and Clefts
Somites
Tail
 
19-24
stage 22
stage 23
stage 24
Allantois
Gut
Head Mesenchyme
Limb Buds
Neural Plate/Tube
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Somites
 

Entry 5

GEISHA IdPTC2.Dunn.2011Data SourcePublication
Complete cDNA Template Probeshow
TGCGGGAAGGTGCTGTTCGTGGGGCTGCTGCTGTTCGGGGCGCTGGCCGTGGGGCTGCGGGTGGCCTCCGTCGAGACGG
ACATCGAGCACCTCTGGGTGGAAGCGGGCAGCCGGGTCAGCCAGGAGCTCCGCTACACGAAGGAGAAGCTGGGCGAGGA
GTCCGTCTACACGTCCCAAATGCTGATCCAGACCCCGAAACGCGAAGGGGAGAACATCCTGACGCAGGAGGCCCTGCAG
CTCCACCTCGAGGCGGCCCTGGCTGCCAGCAAAGTGCAAGTCTCGCTGTACGGAAAATCGTGGGATTTGAACAAGATCT
GCTACAAGTCAGGCGTCCCCATCATTGAGAATGGAATGATCGAGAGGATGATCGAGAAGCTGTTCCCCTGTGTGATCCT
GACGCCGCTGGACTGCTTCTGGGAAGGGGCCAAGCTGCAGGGAGGCTCAGCCTACCTCCCGGGCCGTCCTGATATCCAG
TGGAGCAATTTGGACCCTTTGCAGCTGATGGAGGAGCTGGGGCAGTTCACATCCCTAGAAGGCTTCAAGGAGCTGCTGG
ATAAGGCTGAAGTGGGGCAGGCTTATATGGAGCGGCCCTGCCTGGACCCCCGGGACCCCCATTGCCCCTCCAGTGCCCC
CAACAAGCAGAGCCAGCAGAGCCCCGACATCCCGGCGGAGCTCTCTGGGGGCTGCCATGGGTTCTCCAGGAAGTTCATG
CGCTGGCAGGAGGAGCTGATTTTGGGCGGCACAACCAAAGACTCCCAGGGCAAGCTGCTAAGTGCTGAGGCCCTGCAGA
CAATGTTCCTTCTCATGAGCCCCCGGCAGCTGTATGAGCACTTCAAGGATGACTACGAGATCCATGACATCAGCTGGAG
TGAGGAGAAGGCAGGTGCTATCCTGGAGGCCTGGCAGAGGAAATTTGTGGAGCTGGCACAGGACTCCATCCCACCCAAT
GCCACGCAGAACATCCATGCCTTCTCCACCACCACGCTCAACGACATCATGAAGTCCTTCTCTGACGTCAGTGCCATCC
GAGTGGCTGGGGGATACCTCCTCATGCTGGCCTATGCCTGTGTCACCATGCTGCGCTGGGACTGCTCCAAGTCACAGGG
CGCCGTGGGCCTGGCCGGGGTCCTGCTGGTGGCCCTCTCTGTGGCCTCTGGCTTAGGGCTCTGCTCACTGCTCGGGATC
TCCTTCAATGCAGCCACCACGCAGGTGCTGCCCTTCCTGGCCCTCGGCATTGGTGTGGATGACATGTTCCTCCTGGCTC
ATGCCTTCACCGAGACCAGCCAGCACATCCCCTTCAAGGAGCGGACAGGAGAGTGCCTACGGCGCACAGGGACCAGCGT
GGCTCTCACCTCCGTCAGCAACATGATTGCCTTCTTCATGGCTGCCCTGGTGCCCATCCCCGCCCTGCGTGCCTTCTCG
CTCCAGGCAGCAGTGGTGGTGGTGTTCAACTTCGCCATGGTGCTGTTCATCTTCCCTGCCATACTGAGCCTGGACCTGT
ACCGGCGGGAGAAGCGTCGCCTCGACATCCTCTGCTGCTTCTACAGCCCTTGCTCCTCACGGGTCATCCAGATCCAACC
CCAGGAGTTGGCCGATGCCAACGACAACCATGCCTCCCACCCATCCCCCTACGGCCACCCCGGCGTGGCCACCAGCACT
CAGATCACCACCACCGTGCAGGCCTTCACCCAGTGCGACCCCTCGGGCCACCACATCGTCACCGTCCTGCCACCCACCT
CCCAGGTGTGCACCTCGCCCGCCGTGCTGCTGCCGCCTGCCGACCCGTTGGGCTCGCAGGTCTTCACCCCCTCCAGCTC
CACGCGGGACCTGCTGGCCCAGCTGGATGAGGCCAAAGGCGGGCGCGAGTGCGTGCCGCTGCCCTTGTGCCGCTGGAGC
CTCTCCGACTTTGCCCGTGAGAAGTATGCCCCACTCCTGCTGCGGACCCAGACCAAGGTGGTGGTGGTGGTCCTCTTCT
TGGCGCTGTTGGGACTGAGCCTCTACGGCACCACCATGGTGCATGACGGGCTCTACCTGACAGACATTGTGCCGCGGGA
CACCAAGGCTCACGCCTTCATCTCAGCCCAGTTCAAGTACTTCTCCTTCTACAACATGTTCATTGTCACCAAGGGTGGC
TTCCACTACCCGGGTGCCCAGGCCGCCCTGCTCAGCCTGCACCAGGCCTTCAGCACTGTCAAGTATGTGGTGCGTGAGG
GCAACCATGACCTGCCCAAGATGTGGCTCCACTACTTCCAGGACTGGCTGCGAGGGCTCCAGGCCACCTTTGACAGAGA
CTGGCAAGCCGGCCGCATCACCCATGATAGCTACCGCAACGGCTCCGAGGACGGGGCACTGGCCTACAAGCTCCTCATC
CAGACTGGCAACAAGAAGGAGCCTTTCAACTTCAACCAGCTGACCACACGGCGGTTGGTGGATGAGAATGGCATCATCC
CCCCAGACACCTTCTACATCTGCCTGACGGTGTGGGCCAGCAACGACCCCCTGGGCTTCGCTGCCTCCCAGGCCAACTT
CTACCCGCCGCCGCCTGAGTGGATCCATGACAAGTACGACACTACGGGCGAGAACCTGCGAATCCCGGCAGCCCAGCCG
CTGGAGTTCGCCCAGTTCCCCTTCTACCTGAGCGGGCTGCGTCGCACAGCCGACTTCGTGGAGGCAATTGAGAGCGTGC
GGGCCATCTGCCAGGAGGCGGCCCAGCGCCATGGGGTGCTGAGCTACCCCAGCGGCTACCCCTTCCTCTTCTGGGAGCA
ATACATCGGCCTGCGCCACTGGTTCCTGTTGGCCATCAGCATCTTGCTGGCCTGCACCTTCCTCGTCTGCGCCCTGCTG
CTGCTCAACCCCTGGACGGCCGGTATCATCGTCTCTATCCTGGCCATGATGGCGGTGGAACTGTTTGGCATTATGGGGC
TGATGGGCATCAAGCTGAGTGCCATCCCTGTGGTCATCCTCATCGCTTCAGTTGGCATCGGCGTGGAGTTCACTGTCCA
CGTGGCCCTGGGCTTCCTTACAGCAGTTGGGAGCAGGAACGTGCGCTCAGCCGCTGCCTTGGAGCACACCTTTGCCCCT
GTGATGGACGGCGCCGTCTCCACCCTCCTGGGCGTCCTCATGTTGGCCAGCTCTGAGTTTGACTTCATCATGAGGTACT
TCTTTGCGGTGCTCACCATCCTGACGCTGCTGGGGCTGCTCAACGGGCTGGTGCTGCTGCCCGTCCTGCTCTCAGTCAT
CGGGCCACCCTCTGAGGCATCTCCTGTGGATAACGGCCCCCGCCTGCCCCCTACAGAGCCAGTGCCCCCGTGCCTCGGC
CCTGGGGGTCTGTACATCCGCCGTGCCCCCGCCTGGCCTGCTGCCTTCACCGATACCTCAGACACAGAGTGCTATGGCG
ACGGTGGGGGGCCAGGCAGTCCCCAGGGACCCTTCGTTGTGCCCCCTGCCCCGGCACACATTCTGCTGGAGGCTGGCAA
GGACCCCAGCTTCCCCCGCATCACTGTGCTGAAGCCCTACAAAGACAGCCCGGAGGTCCAGGGAAAGAAGGAGCAGCCC
GTCCCCCAGCCTGCAGCCTCGTTGCCTTTTGGGGAGCCGTGCCCCACAGTGCTCAGAGACTACCCACACCCCACGGCAT
TGCCTCGGCCAGGTCAGCCCTGCTCCTCCAGCGCCTGGCCAGCCTCTCGGGCCCCCCTGCCAGCCTACAGCACCCACCT
GCAGGGCCCCGCCGGCAGCTACACCACAGTCACAGCCACCGCTTCGGTGACGGTTGCCCTGCACCCCACGCTGCCTGGC
TCCTACCCCAGCTTTGGCACCGAGACAGACAGCCTGGAGGAGCCCAGCGCTGTGCCTGACTCCTTTGAGATGCAAAGCC
TGGGACGCCACGGGGCAGGCACCCGGCGCTAG
CitationDunn IC, Paton IR, Clelland AK, Sebastian S, Johnson EJ, McTeir L, Windsor D, Sherman A, Sang H, Burt DW, Tickle C, Davey MG. The chicken polydactyly (Po) locus causes allelic imbalance and ectopic expression of Shh during limb development. Dev Dyn. 2011 May;240(5):1163-72.
CopyrightCopyright © 2011 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # XM_422426.3)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-27
stage 27
stage 27
Limb Buds
 

Entry 6

GEISHA IdPTC2.Davey.2006Data SourcePublication
Complete cDNA Template Probeshow
CCCCGCCATGCCGGCCGAGCCCCCCCGCTCCGCTCCTCCGCGAGCCGCCGCCGCCGCCCTCCGCAAAGCGCTGCCCGAG
GGCCGCGGGGCCCCGCTGTGGCTGCGGGCCCGCTTCCAGGCGCTGCTCTTCGCGCTGGGCTGCCGGATCCAGCGGCACT
GCGGGAAGGTGCTGTTCGTGGGGCTGCTGCTGTTCGGGGCGCTGGCCGTGGGGCTGCGGGTGGCCTCCGTCGAGACGGA
CATCGAGCACCTCTGGGTGGAAGCGGGCAGCCGGGTCAGCCAGGAGCTCCGCTACACGAAGGAGAAGCTGGGCGAGGAG
TCCGTCTACACGTCCCAAATGCTGATCCAGACCCCGAAACGCGAAGGGGAGAACATCCTGACGCAGGAGGCCCTGCAGC
TCCACCTCGAGGCGGCCCTGGCTGCCAGCAAAGTGCAAGTCTCGCTGTACGGAAAATCGTGGGATTTGAACAAGATCTG
CTACAAGTCAGGCGTCCCCATCATTGAGAATGGAATGATCGAGAGGATGATCGAGAAGCTGTTCCCCTGTGTGATCCTG
ACGCCGCTGGACTGCTTCTGGGAAGGGGCCAAGCTGCAGGGAGGCTCAGCCTACCTCCCGGGCCGTCCTGATATCCAGT
GGAGCAATTTGGACCCTTTGCAGCTGATGGAGGAGCTGGGGCAGTTCACATCCCTAGAAGGCTTCAAGGAGCTGCTGGA
TAAGGCTGAGGTGGGGCAGGCTTATATGGAGCGGCCCTGCCTGGACCCCCGGGACCCCCATTGCCCCTCCAGTGCCCCC
AACAAGCAGAGCCAGCAGAGCCCCGACATCCCGGCGGAGCTCTCTGGGGGCTGCCATGGGTTCTCCAGGAAGTTCATGC
GCTGGCAGGAGGAGCTGATTTTAGGCGGCACAACCAAAGACTCCCAGGGCAAGCTGCTAAGTGCTGAGGCCCTGCAGAC
AATGTTCCTTCTCATGAGCCCCCGGCAGCTGTATGAGCACTTCAAGGATGACTACGAGATCCATGACATCAGCTGGAGT
GAGGAGAAGGCAGGTGCTATCCTGGAGGCCTGGCAGAGGAAATTTGTGGAGCTGGCACAGGACTCCATCCCACCCAATG
CCACGCAGAACATCCATGCCTTCTCCACCACCACGCTCAACGACATCATGAAGTCCTTCTCTGACGTCAGTGCCATCCG
AGTGGCTGGGGGATACCTCCTCATGCTGGCCTATGCCTGTGTCACCATGCTGCGCTGGGACTGCTCCAAGTCACAGGGT
GCTGTGGGCCTGGCCGGGGTCCTGCTGGTGGCCCTCTCTGTGGCCTCTGGCTTAGGGCTCTGCTCACTGCTCGGGATCT
CCTTCAATGCAGCCACCACGCAGGTGCTGCCCTTCCTGGCCCTCGGCATTGGTGTGGATGACATGTTCCTCCTGGCTCA
TGCCTTCACCGAGACCAGCCAGCACATCCCCTTCAAGGAGCGGACAGGAGAGTGCCTACGGCGCACGGGGACCAGCGTG
GCTCTCACCTCCGTCAGCAACATGATTGCCTTCTTCATGGCTGCCCTGGTGCCCATCCCCGCCCTGCGTGCCTTCTCAC
TCCAGGCAGCAGTGGTGGTGGTGTTCAACTTCGCCATGGTGCTGTTCATCTTCCCTGCCATACTGAGCCTGGACCTGTA
CCGGCGGGAGAAGCGTCGCCTCGACATCCTCTGCTGCTTCTACAGCCCTTGCTCCTCACGGGTCATCCAGATCCAACCC
CAGGAGTTGGCCGATGCCAACGACAACCATGCCTCCACCGTCCCCTACGGCCACCCCGGCGTGGCCACCAGCACTCAGA
TCACCACCACCGTGCAGGCCTTCACCCAGTGCGACCCCTCGGGCCACCACATCGTCACCGTCCTGCCACCCACCTCCCA
GGTGTGCACCTCGCCCGCCGTGCTGCTGCCGCCTGCCGACCCGTTGGGCTCGCAGGTCTTCACCCCCTCCAGCTCCACG
CGGGACCTGCTGGCCCAGCTGGATGAGGCCAAAGGCGGGCGCGAGTGCGTGCCGCTGCCCTTGTGCCGCTGGAGCCTCT
CCGACTTTGCCCGTGAGAAGTATGCCCCACTCCTGCTGCAGACCCAGACCAAGGTGGTGGTGGTGGTCCTCTTCTTGGC
GCTGTTGGGACTGAGCCTCTACGGCACCACCATGGTGCATGACGGGCTCTACCTGACAGACATTGTGCCGCGGGACACC
AAGGCTCACGCCTTCATCTCAGCCCAGTTCAAGTACTTCTCCTTCTACAACATGTTCATTGTCACCAAGGGTGGCTTCC
ACTACCCGGGTGCCCAGGCCGCCCTGCTCAGCCTGCACCAGGCCTTCAGCACTGTCAAGTATGTGGTGCGTGAGGGCAA
CCATGACCTGCCCAAGATGTGGCTCCACTACTTCCAGGACTGGCTGCGAGGGCTCCAGGCCACCTTTGACAGAGACTGG
CAAGCCGGCCGCATCACCCATGATAGCTACCGCAACGGCTCCGAGGACGGGGCACTGGCCTACAAGCTCCTCATCCAGA
CTGGCAACAAGAAGGAGCCTTTCAACTTCAACCAGCTGACCACACGGCGGTTGGTGGATGAGAATGGCATCATCCCCCC
AGACACCTTCTACATCTGCCTGACGGTGTGGGCCAGCAACGACCCCCTGGGCTTCGCTGCCTCCCAGGCCAACTTCTAC
CCGCCGCCGCCTGAGTGGATCCATGACAAGTACGACACTACGGGCGAGAACCTGCGAAGTGA
CitationDavey MG, Paton IR, Yin Y, Schmidt M, Bangs FK, Morrice DR, Smith TG, Buxton P, Stamataki D, Tanaka M, Münsterberg AE, Briscoe J, Tickle C, Burt DW. The chicken talpid3 gene encodesa novel protein essentialfor Hedgehog signaling. Genes Dev. 2006 May 15; 20(10): 1365–1377.
CopyrightCopyright © 2006, Cold Spring Harbor Laboratory Press
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #AF409095.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
Spinal Cord
Splanchnic Mesoderm
 

Entry 7

GEISHA IdPTC2.Sjödal.2008Data SourcePublication
Complete cDNA Template Probeshow
TGATCCAGACCCCGAAACGCGAAGGGGAGAACATCCTGACGCAGGAGGCCCTGCAGCTCCACCTCGAGGCGGCCCTGGC
TGCCAGCAAAGTGCAAGTCTCGCTGTACGGAAAATCGTGGGATTTGAACAAGATCTGCTACAAGTCAGGCGTCCCCATC
ATTGAGAATGGAATGATCGAGAGGATGATCGAGAAGCTGTTCCCCTGTGTGATCCTGACGCCGCTGGACTGCTTCTGGG
AAGGGGCCAAGCTGCAGGGAGGCTCAGCCTACCTCCCGGGCCGTCCTGATATCCAGTGGAGCAATTTGGACCCTTTGCA
GCTGATGGAGGAGCTGGGGCAGTTCACATCCCTAGAAGGCTTCAAGGAGCTGCTGGATAAGGCTGAGGTGGGGCAGGCT
TATATGGAGCGGCCCTGCCTGGACCCCCGGGACCCCCATTGCCCCTCCAGTGCCCCCAACAAGCAGAGCCAGCAGAGCC
CCGACATCCCGGCGGAGCTCTCTGGGGGCTGCCATGGGTTCTCCAGGAAGTTCATGCGCTGGCAGGAGGAGCTGATTTT
AGGCGGCACAACCAAAGACTCCCAGGGCAAGCTGCTAAGTGCTGAGGCCCTGCAGACAATGTTCCTTCTCATGAGCCCC
CGGCAGCTGTATGAGCACTTCAAGGATGACTACGAGATCCATGACATCAGCTGGAGTGAGGAGAAGGCAGGTGCTATCC
TGGAGGCCTGGCAGAGGAAATTTGTGGAGCTGGCACAGGACTCCATCCCACCCAATGCCACGCAGAACATCCATGCCTT
CTCCACCACCACGCTCAACGACATCATGAAGTCCTTCTCTGACGTCAGTGCCATCCGAGTGGCTGGGGGATACCTCCTC
ATGCTGGCCTATGCCTGTGTCACCATGCTGCGCTGGGACTGCTCCAAGTCACAGGGTGCTGTGGGCCTGGCCGGGGTCC
TGCTGGTGGCCCTCTCTGTGGCCTCTGGCTTAGGGCTCTGCTCACTGCTCGGGATCTCCTTCAATGCAGCCACCACGCA
GGTGCTGCCCTTCCTGGCCCTCGGCATTGGTGTGGATGACATGTTCCTCCTGGCTCATGCCTTCACCGAGACCAGCCAG
CACATCCCCTTCAAGGAGCGGACAGGAGAGTGCCTACGGCGCACGGGGACCAGCGTGGCTCTCACCTCCGTCAGCAACA
TGATTGCCTTCTTCATGGCTGCCCTGGTGCCCATCCCCGCCCTGCGTGCCTTCTCACTCCAGGCAGCAGTGGTGGTGGT
GTTCAACTTCGCCATGGTGCTGTTCATCTTCCCTGCCATACTGAGCCTGGACCTGTACCGGCGGGAGAAGCGTCGCCTC
GACATCCTCTGCTGCTTCTACAGCCCTTGCTCCTCACGGGTCATCCAGATCCAACCCCAGGAGTTGGCCGATGCCAACG
ACAACCATGCCTCC
CitationSjödal M, Gunhaga L. Expression patterns of Shh, Ptc2, Raldh3, Pitx2, Isl1, Lim3 and Pax6 in the developing chick hypophyseal placode and Rathke’s pouch. Gene Expr Patterns. 2008 Sep;8(7-8):481-5. Epub 2008 Jul 4.. DOI: 10.1016/j.gep.2008.06.007.
CopyrightCopyright © 2008 Elsevier B.V.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Sjödal et al. 2008.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Ectoderm
 
7-12
stage 9
stage 10
Ectoderm
arrowhead: prospective hypophyseal placode
arrowhead: prospective hypophyseal placode
ventral neuroectoderm
13-18
stage 13
stage 17
Diencephalon
Ectoderm
oe, oral ectoderm
19-24
stage 20
stage 24
Diencephalon
Rathke's pouch and surrounding mesenchyme
all
 
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.935

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona