GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ETV4
ETS variant 4

Gene
Official SymbolETV4
Official Full NameETS variant 4
CGNC ID807
also known asPEA3, ETS translocation variant 4|ets domain protein|ets variant gene 4 (E1A enhancer binding protein, E1AF), Pea3, Ets domain protein Pea 3, ETV4
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418106
PolypeptideXP_418106
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.446
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2118ENSG00000175832MIM:600711
Mouse18612ENSMUSG00000017724All phenotypic alleles (3):Targeted, knock-out(1) Targeted, other(2) MGI:99423
Xenopus100486339, 3991356051132
Zebrafish30700ENSDARG00000018303ZDB-GENE-990415-71ZFIN:ZDB-GENE-990415-71
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395747
Ensembl Gene
KEGGgga:395747

Entry 1

GEISHA IdETV4.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATGCCGCTCTCTTCGCTACTATTATG
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGTGCCCTGTGCTGGTTTTAGGcDNA Template Length1054
Complete cDNA Template Probeshow
TTTTTTTAAAAAATTTGGCCGCAATATGCCGCTTTTTCGCTACTATTATGAAAAGGCATCATGCAGAAGGTGGCAGGGA
ACGCTACGTCTACAAGTTTGTGTGTGAGCCCCGAGGCTCTGTTCTCTTGGCCTTCCCTGACAACCAGCGGCCAGCCCTG
AAGGCAGAGCTGGAGAGGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCCCACCTGGATGAGAGCACTGCTTACCTG
CCTGACCTTGGGAGCCTCCCCCCCGCAGCTCTATGGCAAAGGCTACACCTACTAGAGCTGCTGGAGCCGTGTGCCACCC
TGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTTTCCCAGGCCAGCCTGGGGCTGCACAG
AGCTATGATACCTGCTGTGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGTTGGATAACCAGCAGGGGGTCAATGGGGCT
GCTGGGTGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCAGTGTGAAGTCATCACCTGAGCAGGGC
AGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACCTACAGCATTCCTCCCCCCTTGGCAGA
TGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCTGCTGGCTGCCTTCCTCCAGTGCTGAC
CCCCTGGGTATATTGCCCTCAGCCGGGGCAGCCCAACCTGTGCAGATTCACCTCCTCAGGGCCAACCTTCTCTTCTGCC
CAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTTCCCCTGAATTGCTCTGTTGGCACTGAAAGTGCCTGTCCC
GTACGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCAGGGCTGCCAACATGTTCTTGAGCTGGG
CAGCTGAAGGTGTGGGCCAGGGTGAAGCACTTCCCCGGTGCATGCCCTAAAACCAGCCAGGGCACCTTTATTGGGTTAA
TTTTTTTAAAAAAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 5
stage 6
Epiblast
Hensen's Node
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Primitive Streak
Somites
 
7-12
stage 7
stage 8
stage 8
stage 9
stage 10
stage 11
stage 11
stage 12
Anterior Intestinal Portal
Ectoderm
Forebrain
Head Mesenchyme
Heart
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Primitive Streak
Somites
HH 10-
13-18
stage 15
stage 16
Ear/Otic Placode
Forebrain
Head Mesenchyme
Heart
Lateral Plate Mesoderm
Midbrain
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Somites
Sections pending.
19-24
stage 21
stage 22
stage 23
Ear/Otic Placode
Eye
Forebrain
Heart
Leg
Limb Buds
Myotome
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Somites
Tail
Wing
Sections pending.
25
stage 25
stage 25
Ear/Otic Placode
Eye
Head Mesenchyme
Hindbrain
Leg
Myotome
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Somites
Tail
Wing
Sections pending.

Entry 2

GEISHA IdPea3.Lunn.2007Data SourcePublication
Complete cDNA Template Probeshow
CCGAGCTCGTGAAGGCGGCGATGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGG
GCTGCGTGGGGCTCCGCATGGGCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTA
GCGCCCGGGCGGCAGGATGAAGGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCCCAGCCGCCGCCGGGCCATGCG
GGCTCCGGGTGCCGGACTCCGACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAG
ACCTCTTCCAGGACTTGAGCCAGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGT
GCCTGACTTCCATTCAGAAAACCCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGAC
CCCACGCTGTCCTGCAACCACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATC
AACCCAGACCGGTTGGGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGA
CAGGAACTTCCTGACCCCTTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTAC
CAGCCACCTGTGGAGATGTGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCC
CCATGTCTGAGCAATGCCTTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGG
CAGCAGCTGCCAGTACCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTAT
GACAAGCAGATGAGGCCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGG
TCGGAGGGTACCGGGAGGGCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGA
TGATCCCACCAACTCCCACTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCC
AGGCTGTGGGGCATCCAGAAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGA
AAGGCATCATGCAGAAGGTGGCGGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGC
CTTCCCTGACAACCAGCGGCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCC
CACCTGGATGAGAGCACTGCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGTTACACCTACT
AGTGCTGCTGGAGCTGTGTGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTT
TCCCAGGCCAGCCTGGGGCTGCACAGAGCTATGATACCTGCTGAGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGCTGG
ATAACCAGCAGGGGGTCAATGGGGCTGCTGGGGGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCA
GTGTGAAGTCATCACCTGAGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACC
TACAGCATTCCTCCCCCCTTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCT
GCTGGCTGCCTTCCTCCAGTGCTGACCCCCTGGGTATATTGCCCTCAGCCAGGGCAGCCCAGACCTGTGCAGATTCACC
TCCTCAGGGCCAACCTTCTCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCT
CTGTTGGCACTGAGAAGTGCCTGTCCCGTATGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCA
GGGCTGCCACATGTTCTTGAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAA
ACCAGCACAGGGCAAGCACAGAGCTTCCTGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTA
CCACCAGGCCATATGTGTGGCATGGCTGTTCCAGTCTAGACAAGGGCTAGAACCGTCTCTAGGATCTTTGGAGGCTCAG
GGACTTGGCTAGAAAATCACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGGAGGCATTATGAATACACTCTACAAAGTA
ACTTAAATCAGAGCTCTTAACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGT
GTTGGAAAGGCAGATATCTCTGCAGCCCGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACACTTACAGTGGGCA
CCACATCCCCGGGGAGAGGTGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGG
TGAATCTGTACCAAAACAGCCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGC
AGCAGCCCCTCCTGGGGGGCTCAGGAGCAGCCCCTTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTG
CTGCCTCATCCCACTCTACCGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTG
CCTTTACTATTTATGAGTGTAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
CitationLunn JS, Fishwick KJ, Halley PA, Storey KG. A spatial and temporal map of FGF/Erk1/2 activity and response repertoires in the early chick embryo. Dev Biol. 2007 Feb 15;302(2):536-52. Epub 2006 Oct 14.
CopyrightCopyright © 2006 Elsevier Inc. All rights reserved.
CommentsInsufficient information in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_418106.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
stage 3
Epiblast
Primitive Streak
Stage X
4-6
stage 4
stage 6
Hensen's Node
Hindbrain
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Primitive Streak
Somites
Epressed in neural floor plate, precardiac mesoderm
7-10
stage 8
stage 10
stage 10
Ectoderm
Forebrain
Hindbrain
Intermediate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
Precardiac mesoderm
Undetectable in neural tube flanked by somites

Entry 3

GEISHA IdPEA3.UAcloneData SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CCGAGCTCGTGAAGGCGGCGATGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGG
GCTGCGTGGGGCTCCGCATGGGCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTA
GCGCCCGGGCGGCAGGATGAAGGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCCCAGCCGCCGCCGGGCCATGCG
GGCTCCGGGTGCCGGACTCCGACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAG
ACCTCTTCCAGGACTTGAGCCAGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGT
GCCTGACTTCCATTCAGAAAACCCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGAC
CCCACGCTGTCCTGCAACCACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATC
AACCCAGACCGGTTGGGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGA
CAGGAACTTCCTGACCCCTTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTAC
CAGCCACCTGTGGAGATGTGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCC
CCATGTCTGAGCAATGCCTTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGG
CAGCAGCTGCCAGTACCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTAT
GACAAGCAGATGAGGCCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGG
TCGGAGGGTACCGGGAGGGCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGA
TGATCCCACCAACTCCCACTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCC
AGGCTGTGGGGCATCCAGAAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGA
AAGGCATCATGCAGAAGGTGGCGGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGC
CTTCCCTGACAACCAGCGGCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCC
CACCTGGATGAGAGCACTGCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGTTACACCTACT
AGTGCTGCTGGAGCTGTGTGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTT
TCCCAGGCCAGCCTGGGGCTGCACAGAGCTATGATACCTGCTGAGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGCTGG
ATAACCAGCAGGGGGTCAATGGGGCTGCTGGGGGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCA
GTGTGAAGTCATCACCTGAGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACC
TACAGCATTCCTCCCCCCTTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCT
GCTGGCTGCCTTCCTCCAGTGCTGACCCCCTGGGTATATTGCCCTCAGCCAGGGCAGCCCAGACCTGTGCAGATTCACC
TCCTCAGGGCCAACCTTCTCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCT
CTGTTGGCACTGAGAAGTGCCTGTCCCGTATGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCA
GGGCTGCCACATGTTCTTGAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAA
ACCAGCACAGGGCAAGCACAGAGCTTCCTGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTA
CCACCAGGCCATATGTGTGGCATGGCTGTTCCAGTCTAGACAAGGGCTAGAACCGTCTCTAGGATCTTTGGAGGCTCAG
GGACTTGGCTAGAAAATCACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGGAGGCATTATGAATACACTCTACAAAGTA
ACTTAAATCAGAGCTCTTAACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGT
GTTGGAAAGGCAGATATCTCTGCAGCCCGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACACTTACAGTGGGCA
CCACATCCCCGGGGAGAGGTGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGG
TGAATCTGTACCAAAACAGCCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGC
AGCAGCCCCTCCTGGGGGGCTCAGGAGCAGCCCCTTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTG
CTGCCTCATCCCACTCTACCGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTG
CCTTTACTATTTATGAGTGTAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Head Mesenchyme
Intermediate Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
 
13-18
stage 15
stage 15
stage 18
stage 18
Face Mesenchyme
Heart Tube
Intermediate Mesoderm
Lateral Plate Mesoderm
Limb Buds
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Somatopleure
Somites
Splanchnic Mesoderm
Surface Ectoderm
Tail
Wing
 
19-24
stage 24
Ear/Otic Placcode
Eye
Face Mesenchyme
Limb Buds
Pharyngeal Arches and Clefts
Somites
 

Entry 4

GEISHA IdPea3.McCabe.2006Data SourcePublication
Complete cDNA Template Probeshow
CCGAGCTCGTGAAGGCGGCGATGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGG
GCTGCGTGGGGCTCCGCATGGGCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTA
GCGCCCGGGCGGCAGGATGAAGGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCCCAGCCGCCGCCGGGCCATGCG
GGCTCCGGGTGCCGGACTCCGACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAG
ACCTCTTCCAGGACTTGAGCCAGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGT
GCCTGACTTCCATTCAGAAAACCCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGAC
CCCACGCTGTCCTGCAACCACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATC
AACCCAGACCGGTTGGGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGA
CAGGAACTTCCTGACCCCTTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTAC
CAGCCACCTGTGGAGATGTGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCC
CCATGTCTGAGCAATGCCTTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGG
CAGCAGCTGCCAGTACCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTAT
GACAAGCAGATGAGGCCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGG
TCGGAGGGTACCGGGAGGGCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGA
TGATCCCACCAACTCCCACTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCC
AGGCTGTGGGGCATCCAGAAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGA
AAGGCATCATGCAGAAGGTGGCGGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGC
CTTCCCTGACAACCAGCGGCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCC
CACCTGGATGAGAGCACTGCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGTTACACCTACT
AGTGCTGCTGGAGCTGTGTGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTT
TCCCAGGCCAGCCTGGGGCTGCACAGAGCTATGATACCTGCTGAGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGCTGG
ATAACCAGCAGGGGGTCAATGGGGCTGCTGGGGGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCA
GTGTGAAGTCATCACCTGAGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACC
TACAGCATTCCTCCCCCCTTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCT
GCTGGCTGCCTTCCTCCAGTGCTGACCCCCTGGGTATATTGCCCTCAGCCAGGGCAGCCCAGACCTGTGCAGATTCACC
TCCTCAGGGCCAACCTTCTCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCT
CTGTTGGCACTGAGAAGTGCCTGTCCCGTATGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCA
GGGCTGCCACATGTTCTTGAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAA
ACCAGCACAGGGCAAGCACAGAGCTTCCTGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTA
CCACCAGGCCATATGTGTGGCATGGCTGTTCCAGTCTAGACAAGGGCTAGAACCGTCTCTAGGATCTTTGGAGGCTCAG
GGACTTGGCTAGAAAATCACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGGAGGCATTATGAATACACTCTACAAAGTA
ACTTAAATCAGAGCTCTTAACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGT
GTTGGAAAGGCAGATATCTCTGCAGCCCGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACACTTACAGTGGGCA
CCACATCCCCGGGGAGAGGTGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGG
TGAATCTGTACCAAAACAGCCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGC
AGCAGCCCCTCCTGGGGGGCTCAGGAGCAGCCCCTTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTG
CTGCCTCATCCCACTCTACCGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTG
CCTTTACTATTTATGAGTGTAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
CitationMcCabe KL, McGuire C, Reh TA. Pea3 expression is regulated by FGF signaling in developing retina. Dev Dyn. 2006 Feb;235(2):327-35.
CopyrightCopyright © 2006 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI XM_418106.2
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
stage 23
stage 23
stage 23
stage 23
Lens
Retina
 
25
stage 25
Lens
Retina
 

Entry 5

GEISHA IdPea3.Brent.2004Data SourcePublication
Complete cDNA Template Probeshow
CCGAGCTCGTGAAGGCGGCGATGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGG
GCTGCGTGGGGCTCCGCATGGGCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTA
GCGCCCGGGCGGCAGGATGAAGGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCCCAGCCGCCGCCGGGCCATGCG
GGCTCCGGGTGCCGGACTCCGACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAG
ACCTCTTCCAGGACTTGAGCCAGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGT
GCCTGACTTCCATTCAGAAAACCCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGAC
CCCACGCTGTCCTGCAACCACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATC
AACCCAGACCGGTTGGGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGA
CAGGAACTTCCTGACCCCTTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTAC
CAGCCACCTGTGGAGATGTGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCC
CCATGTCTGAGCAATGCCTTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGG
CAGCAGCTGCCAGTACCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTAT
GACAAGCAGATGAGGCCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGG
TCGGAGGGTACCGGGAGGGCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGA
TGATCCCACCAACTCCCACTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCC
AGGCTGTGGGGCATCCAGAAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGA
AAGGCATCATGCAGAAGGTGGCGGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGC
CTTCCCTGACAACCAGCGGCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCC
CACCTGGATGAGAGCACTGCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGTTACACCTACT
AGTGCTGCTGGAGCTGTGTGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTT
TCCCAGGCCAGCCTGGGGCTGCACAGAGCTATGATACCTGCTGAGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGCTGG
ATAACCAGCAGGGGGTCAATGGGGCTGCTGGGGGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCA
GTGTGAAGTCATCACCTGAGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACC
TACAGCATTCCTCCCCCCTTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCT
GCTGGCTGCCTTCCTCCAGTGCTGACCCCCTGGGTATATTGCCCTCAGCCAGGGCAGCCCAGACCTGTGCAGATTCACC
TCCTCAGGGCCAACCTTCTCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCT
CTGTTGGCACTGAGAAGTGCCTGTCCCGTATGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCA
GGGCTGCCACATGTTCTTGAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAA
ACCAGCACAGGGCAAGCACAGAGCTTCCTGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTA
CCACCAGGCCATATGTGTGGCATGGCTGTTCCAGTCTAGACAAGGGCTAGAACCGTCTCTAGGATCTTTGGAGGCTCAG
GGACTTGGCTAGAAAATCACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGGAGGCATTATGAATACACTCTACAAAGTA
ACTTAAATCAGAGCTCTTAACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGT
GTTGGAAAGGCAGATATCTCTGCAGCCCGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACACTTACAGTGGGCA
CCACATCCCCGGGGAGAGGTGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGG
TGAATCTGTACCAAAACAGCCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGC
AGCAGCCCCTCCTGGGGGGCTCAGGAGCAGCCCCTTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTG
CTGCCTCATCCCACTCTACCGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTG
CCTTTACTATTTATGAGTGTAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
CitationBrent AE, Tabin CJ. FGF acts directly on the somitic tendon progenitors through the Ets transcription factors Pea3 and Erm to regulate scleraxis expression. Development. 2004 Aug;131(16):3885-96. Epub 2004 Jul 14.
CopyrightThis material is protected by copyright. The Company of Biologists' (publishers of Development) hold an Exclusive License obtained from the authors, who retain copyright.
CommentsAuthors said probe for "chick Pea3 (RT-PCR product using primers 5′ ACGTCTAGAGTGCATAATAACCATAGG 3′ and 5′ ACGGAATTCCTAGTAGGTGTAGCCTTTGCC 3′)". As these sequences were not present in the current mRNA listed for this gene, probe sequence posted here is from NCBI Acc # XM_418106.2.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
Dermomyotome
Limb Buds
 

Entry 6

GEISHA IdPEA3.Firnberg.2002Data SourcePublication
Complete cDNA Template Probeshow
CCGAGCTCGTGAAGGCGGCGATGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGG
GCTGCGTGGGGCTCCGCATGGGCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTA
GCGCCCGGGCGGCAGGATGAAGGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCCCAGCCGCCGCCGGGCCATGCG
GGCTCCGGGTGCCGGACTCCGACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAG
ACCTCTTCCAGGACTTGAGCCAGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGT
GCCTGACTTCCATTCAGAAAACCCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGAC
CCCACGCTGTCCTGCAACCACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATC
AACCCAGACCGGTTGGGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGA
CAGGAACTTCCTGACCCCTTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTAC
CAGCCACCTGTGGAGATGTGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCC
CCATGTCTGAGCAATGCCTTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGG
CAGCAGCTGCCAGTACCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTAT
GACAAGCAGATGAGGCCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGG
TCGGAGGGTACCGGGAGGGCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGA
TGATCCCACCAACTCCCACTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCC
AGGCTGTGGGGCATCCAGAAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGA
AAGGCATCATGCAGAAGGTGGCGGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGC
CTTCCCTGACAACCAGCGGCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCC
CACCTGGATGAGAGCACTGCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGTTACACCTACT
AGTGCTGCTGGAGCTGTGTGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTT
TCCCAGGCCAGCCTGGGGCTGCACAGAGCTATGATACCTGCTGAGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGCTGG
ATAACCAGCAGGGGGTCAATGGGGCTGCTGGGGGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCA
GTGTGAAGTCATCACCTGAGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACC
TACAGCATTCCTCCCCCCTTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCT
GCTGGCTGCCTTCCTCCAGTGCTGACCCCCTGGGTATATTGCCCTCAGCCAGGGCAGCCCAGACCTGTGCAGATTCACC
TCCTCAGGGCCAACCTTCTCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCT
CTGTTGGCACTGAGAAGTGCCTGTCCCGTATGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCA
GGGCTGCCACATGTTCTTGAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAA
ACCAGCACAGGGCAAGCACAGAGCTTCCTGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTA
CCACCAGGCCATATGTGTGGCATGGCTGTTCCAGTCTAGACAAGGGCTAGAACCGTCTCTAGGATCTTTGGAGGCTCAG
GGACTTGGCTAGAAAATCACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGGAGGCATTATGAATACACTCTACAAAGTA
ACTTAAATCAGAGCTCTTAACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGT
GTTGGAAAGGCAGATATCTCTGCAGCCCGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACACTTACAGTGGGCA
CCACATCCCCGGGGAGAGGTGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGG
TGAATCTGTACCAAAACAGCCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGC
AGCAGCCCCTCCTGGGGGGCTCAGGAGCAGCCCCTTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTG
CTGCCTCATCCCACTCTACCGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTG
CCTTTACTATTTATGAGTGTAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
CitationFirnberg N, Neubüser A (2005).FGF signaling regulates expression of Tbx2, Erm, Pea3, and Pax3 in the early nasal region. Dev Biol. 2002 Jul 15;247(2):237-50.
Copyright"Reprinted from Developmental Biology, 247(2), Firnberg N, Neubüser A, FGF signaling regulates expression of Tbx2, Erm, Pea3, and Pax3 in the early nasal region, 237-50., Copyright (2002), with permission from Elsevier". Copyright © (2002) Elsevier B.V. All rights reserved.
CommentsAccording to authors, "The plasmids used to prepare the antisense riboprobes employed in this study have previously been described (refs)." As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #XM_418106.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
Face Mesenchyme
Forebrain
 
19-24
stage 24
Face Mesenchyme
Forebrain
 
31-44
stage 44
Ectoderm
Face Mesenchyme
Forebrain
 

Entry 7

GEISHA IdPEA3.Blentic.2008Data SourcePublication
Complete cDNA Template Probeshow
GTGCATAATAACCATAGGATTGTAACGCTCCAATATCTGTTTGACTCCCCCAGTGCCTATGATCAACCCAGACCGGTTG
GGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGTTCCAGCAGTTCCCCAGACAGGACAGGAACTTCCTGAC
CCCTTCAGGGCCACCCCACCCCACATCCAGCTGGGGATACCTCATTGAAAACAGCTCTGCCTACCAGGCACCTGTGGAG
ATGTGCCACTCCTTCCACTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGTCTACCAGCGCCCCATGTCTGAGCAAT
GCCTTCAGTGCCCCCCGCAGGGCTTCAAGCAGGAGTTTCATGACCCACAGTATGAGCAGGCGGGCAGGAGCTGCCAGTA
CCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTATGACAAGCAGATGAGG
CCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGGTGACATCAAGCAGGAGGTCGGAGGGTACCGGGAGG
GCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGATGATCCCACCAACTCCCA
CTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCCAGGCTGTGGGGCATCCAG
AAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGAAAGGCATCATGCAGAAGG
TGGCAGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGCCTTCCCTGACAACCAGCG
GCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCCCACCTGGATGAGAGCACT
GCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGCTACACCTACTAGAGCTGCTGGAGCCGTG
TGCCACCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTTTCCCAGGCCAGCCTGGGGC
TGCACAGAGCTATGATACCTGCTGTGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGTTGGATAACCAGCAGGGGGTCAA
TGGGGCTGCTGGGTGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCAGTGTGAAGTCATCACCTGA
GCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACCTACAGCATTCCTCCCCCCT
TGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCTGCTGGCTGCCTTCCTCCAG
TGCTGACCCCCTGGGTATATTGCCCTCAGCCGGGGCAGCCCAGACCTGTGCAGATTCACCTCCTCAGGGCCAACCTTCT
CTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCTCTGTTGGCACTGAGAAGTG
CCTGTCCCGTACGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCAGGGCTGCCACATGTTCTTG
AGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAAACCAGCACAGGGCAAGCAC
AGAGCTTCCAGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTACCACCAGGCCATATGTGTG
GCATGGCTGTTCCAGCCTAGACAAGGGCTAGAACCATCTCTAGGATCTTTGGAGGCTCAGGGACTTGGCTAGAAAATCA
CCTGAGGTGTGAAAAGAACCTGGGGGGGGGGAGGCATTATGAATACACTCTAAAAAGTAACTTAAATCGGAGCTCTTAA
CATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGTGTTGGAAAGGCAGATATCTC
TGCAGCCTGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACATTTACAGTGGGCACCACATCCCCGGGGAGAGGT
GCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGGTGAATCTGTACCAAAACAGC
CTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGCAGCAGCCCCTCCTGGGGGGC
TCAGGAGCAGCCCCCTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTGCTGCCTCATCCCACTCTACC
GCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTGCCTTTACTATTTATGAGTGT
AAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTGAAAAAAAAANAAAAAAAAA
CitationBlentic A, Tandon P, Payton S, Walshe J, Carney T, Kelsh RN, Mason I, Graham A. The emergence of ectomesenchyme. Dev Dyn. 2008 Mar;237(3):592-601.
CopyrightCopyright © 2008 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #AF075708.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
stage 11
Anterior Neuropore
Ear/Otic Placode
Hindbrain
Isthmus/MHB
 

Entry 8

GEISHA IdPEA3.Ferrer-Vaquer.2008Data SourcePublication
Complete cDNA Template Probeshow
GTGCATAATAACCATAGGATTGTAACGCTCCAATATCTGTTTGACTCCCCCAGTGCCTATGATCAACCCAGACCGGTTG
GGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGTTCCAGCAGTTCCCCAGACAGGACAGGAACTTCCTGAC
CCCTTCAGGGCCACCCCACCCCACATCCAGCTGGGGATACCTCATTGAAAACAGCTCTGCCTACCAGGCACCTGTGGAG
ATGTGCCACTCCTTCCACTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGTCTACCAGCGCCCCATGTCTGAGCAAT
GCCTTCAGTGCCCCCCGCAGGGCTTCAAGCAGGAGTTTCATGACCCACAGTATGAGCAGGCGGGCAGGAGCTGCCAGTA
CCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTATGACAAGCAGATGAGG
CCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGGTGACATCAAGCAGGAGGTCGGAGGGTACCGGGAGG
GCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGATGATCCCACCAACTCCCA
CTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCCAGGCTGTGGGGCATCCAG
AAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGAAAGGCATCATGCAGAAGG
TGGCAGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGCCTTCCCTGACAACCAGCG
GCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCCCACCTGGATGAGAGCACT
GCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGCTACACCTACTAGAGCTGCTGGAGCCGTG
TGCCACCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTTTCCCAGGCCAGCCTGGGGC
TGCACAGAGCTATGATACCTGCTGTGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGTTGGATAACCAGCAGGGGGTCAA
TGGGGCTGCTGGGTGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCAGTGTGAAGTCATCACCTGA
GCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACCTACAGCATTCCTCCCCCCT
TGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCTGCTGGCTGCCTTCCTCCAG
TGCTGACCCCCTGGGTATATTGCCCTCAGCCGGGGCAGCCCAGACCTGTGCAGATTCACCTCCTCAGGGCCAACCTTCT
CTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCTCTGTTGGCACTGAGAAGTG
CCTGTCCCGTACGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCAGGGCTGCCACATGTTCTTG
AGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAAACCAGCACAGGGCAAGCAC
AGAGCTTCCAGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTACCACCAGGCCATATGTGTG
GCATGGCTGTTCCAGCCTAGACAAGGGCTAGAACCATCTCTAGGATCTTTGGAGGCTCAGGGACTTGGCTAGAAAATCA
CCTGAGGTGTGAAAAGAACCTGGGGGGGGGGAGGCATTATGAATACACTCTAAAAAGTAACTTAAATCGGAGCTCTTAA
CATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGTGTTGGAAAGGCAGATATCTC
TGCAGCCTGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACATTTACAGTGGGCACCACATCCCCGGGGAGAGGT
GCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGGTGAATCTGTACCAAAACAGC
CTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGCAGCAGCCCCTCCTGGGGGGC
TCAGGAGCAGCCCCCTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTGCTGCCTCATCCCACTCTACC
GCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTGCCTTTACTATTTATGAGTGT
AAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTGAAAAAAAAANAAAAAAAAA
CitationFerrer-Vaquer A, Maurey P, Werzowa J, Firnberg N, Leibbrandt A, Neubüser A. Expression and regulation of HTRA1 during chick and early mouse development. Dev Dyn. 2008 Jul;237(7):1893-900.
Copyright© 2008 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # AF075708.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
stage 11
Forebrain
Head Mesenchyme
Heart
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Paraxial Mesoderm
 

Entry 9

GEISHA IdPEA3.Betancur.2011Data SourcePublication
Complete cDNA Template Probeshow
CCGAGCTCGTGAAGGCGGCGATGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGG
GCTGCGTGGGGCTCCGCATGGGCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTA
GCGCCCGGGCGGCAGGATGAAGGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCCCAGCCGCCGCCGGGCCATGCG
GGCTCCGGGTGCCGGACTCCGACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAG
ACCTCTTCCAGGACTTGAGCCAGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGT
GCCTGACTTCCATTCAGAAAACCCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGAC
CCCACGCTGTCCTGCAACCACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATC
AACCCAGACCGGTTGGGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGA
CAGGAACTTCCTGACCCCTTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTAC
CAGCCACCTGTGGAGATGTGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCC
CCATGTCTGAGCAATGCCTTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGG
CAGCAGCTGCCAGTACCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTAT
GACAAGCAGATGAGGCCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGG
TCGGAGGGTACCGGGAGGGCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGA
TGATCCCACCAACTCCCACTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCC
AGGCTGTGGGGCATCCAGAAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGA
AAGGCATCATGCAGAAGGTGGCGGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGC
CTTCCCTGACAACCAGCGGCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCC
CACCTGGATGAGAGCACTGCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGTTACACCTACT
AGTGCTGCTGGAGCTGTGTGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTT
TCCCAGGCCAGCCTGGGGCTGCACAGAGCTATGATACCTGCTGAGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGCTGG
ATAACCAGCAGGGGGTCAATGGGGCTGCTGGGGGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCA
GTGTGAAGTCATCACCTGAGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACC
TACAGCATTCCTCCCCCCTTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCT
GCTGGCTGCCTTCCTCCAGTGCTGACCCCCTGGGTATATTGCCCTCAGCCAGGGCAGCCCAGACCTGTGCAGATTCACC
TCCTCAGGGCCAACCTTCTCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCT
CTGTTGGCACTGAGAAGTGCCTGTCCCGTATGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCA
GGGCTGCCACATGTTCTTGAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAA
ACCAGCACAGGGCAAGCACAGAGCTTCCTGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTA
CCACCAGGCCATATGTGTGGCATGGCTGTTCCAGTCTAGACAAGGGCTAGAACCGTCTCTAGGATCTTTGGAGGCTCAG
GGACTTGGCTAGAAAATCACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGGAGGCATTATGAATACACTCTACAAAGTA
ACTTAAATCAGAGCTCTTAACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGT
GTTGGAAAGGCAGATATCTCTGCAGCCCGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACACTTACAGTGGGCA
CCACATCCCCGGGGAGAGGTGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGG
TGAATCTGTACCAAAACAGCCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGC
AGCAGCCCCTCCTGGGGGGCTCAGGAGCAGCCCCTTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTG
CTGCCTCATCCCACTCTACCGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTG
CCTTTACTATTTATGAGTGTAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
CitationBetancur P, Sauka-Spengler T, Bronner M. A Sox10 enhancer element common to the otic placode and neural crest is activated by tissue-specific paralogs. Development. 2011 Sep;138(17):3689-98.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # AF075708).
no images

Entry 10

GEISHA IdPEA3.Aragon.2009Data SourcePublication
Complete cDNA Template Probeshow
GTGCATAATAACCATAGGATTGTAACGCTCCAATATCTGTTTGACTCCCCCAGTGCCTATGATCAACCCAGACCGGTTG
GGATCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGTTCCAGCAGTTCCCCAGACAGGACAGGAACTTCCTGAC
CCCTTCAGGGCCACCCCACCCCACATCCAGCTGGGGATACCTCATTGAAAACAGCTCTGCCTACCAGGCACCTGTGGAG
ATGTGCCACTCCTTCCACTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGTCTACCAGCGCCCCATGTCTGAGCAAT
GCCTTCAGTGCCCCCCGCAGGGCTTCAAGCAGGAGTTTCATGACCCACAGTATGAGCAGGCGGGCAGGAGCTGCCAGTA
CCCAGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTATGACAAGCAGATGAGG
CCCTTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGGTGACATCAAGCAGGAGGTCGGAGGGTACCGGGAGG
GCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGATGATCCCACCAACTCCCA
CTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCCAGGCTGTGGGGCATCCAG
AAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGAAAGGCATCATGCAGAAGG
TGGCAGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGCCTTCCCTGACAACCAGCG
GCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCCCACCTGGATGAGAGCACT
GCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGCTACACCTACTAGAGCTGCTGGAGCCGTG
TGCCACCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTTTCCCAGGCCAGCCTGGGGC
TGCACAGAGCTATGATACCTGCTGTGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGTTGGATAACCAGCAGGGGGTCAA
TGGGGCTGCTGGGTGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCAGTGTGAAGTCATCACCTGA
GCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACCTACAGCATTCCTCCCCCCT
TGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCTGCTGGCTGCCTTCCTCCAG
TGCTGACCCCCTGGGTATATTGCCCTCAGCCGGGGCAGCCCAGACCTGTGCAGATTCACCTCCTCAGGGCCAACCTTCT
CTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCTCTGTTGGCACTGAGAAGTG
CCTGTCCCGTACGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCAGGGCTGCCACATGTTCTTG
AGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAAACCAGCACAGGGCAAGCAC
AGAGCTTCCAGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTACCACCAGGCCATATGTGTG
GCATGGCTGTTCCAGCCTAGACAAGGGCTAGAACCATCTCTAGGATCTTTGGAGGCTCAGGGACTTGGCTAGAAAATCA
CCTGAGGTGTGAAAAGAACCTGGGGGGGGGGAGGCATTATGAATACACTCTAAAAAGTAACTTAAATCGGAGCTCTTAA
CATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGTGTTGGAAAGGCAGATATCTC
TGCAGCCTGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACATTTACAGTGGGCACCACATCCCCGGGGAGAGGT
GCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGGTGAATCTGTACCAAAACAGC
CTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGCAGCAGCCCCTCCTGGGGGGC
TCAGGAGCAGCCCCCTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTGCTGCCTCATCCCACTCTACC
GCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTGCCTTTACTATTTATGAGTGT
AAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTGAAAAAAAAANAAAAAAAAA
CitationFerran Aragon, Cristina Pujades. FGF signaling controls caudal hindbrain specification through Ras-ERK1/2 pathway. BMC Dev Biol. 2009; 9: 61.
CopyrightCopyright ©2009 Aragon and Pujades; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #AF075708.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 7
stage 8
stage 8
stage 8
stage 8
stage 8
stage 10
stage 10
stage 10
stage 10
Anterior Intestinal Portal
Endoderm
Head Mesenchyme
Hindbrain
Isthmus/MHB
Midbrain
Notochord
Paraxial Mesoderm
Primitive Streak
Somites
HH stage 7+
HH stage 8+

Entry 11

GEISHA IdPea3.Betancur.2011Data SourcePublication
Complete cDNA Template Probeshow
TACAAAACCTGAGCTCTTCACCCAGCTGTTTATTTTTATAAAACTGCAGGTCTGCTTATGCTCTATTCTAAATGTGTCT
CTGCACCTCTGCACTTCAGTCAAGAAAAGAGTCAAGAAAGCTGGGAAGGTTATTTTTGTGTTACAGAGATGGGGAAGTG
AGAAGACAACCATGCAGAGACATAAGGCCTCTGTCAGTTCTGTCATTGCCCACTGGATGGGAAATTAGAACATCATAAA
GCAAACAAATATAACAGTGGAAAATCCCATCCGGTTCAGAGCGCAGCCATATGCTGAAATCAGATCTGAAATAACAAAG
GTTCCATTATATCTTAACCAGGAAATGCAGCATTAATAACCAAGAGTTAAATGGCTATTTTGCAATGACCTGTATAGCA
GAAAGTGCAAAGCAAAGCAGGGGTATCTGGTGTCTCATAGACTTTGCAGGACACTTAAAGTATGAATTGCTTAACAGCA
ATCTAACTGGGGGACGTATTCTCTTGCAGCTTCCCAGTAGCATTCGATTGAAGTTAACTGCTTGAACAAATTGCTACAA
AACAATATCTGTATATTCTGTATATCTGTATATAATATCCCCAGTAATATCTGGGGATGCGCTATAAGTTAGCATGTTC
TTGTTTTGCCCCCATGAACAGATTAAAACTGCATTTGGGGCTGTTTTCCTGACAGAGTGGGTTCCTGGTAATGCTGGAG
CTGCCTTTTTTTTCCAGCAGAAAGATTAAAATACCCTTAAACTGAATACTTTTCCATCATACACGTGTCATGCTGATTG
CATTGGCTGCAGAGAAAACATGACAAAGATGCACAGTTTCTATATAGTATTAAGAGTAATTTGTGCTCATCCCTTCCTG
TGCAGCAAGAGTAAAACTGGTTTTGGTTGCTTGGGCTTTAATTATTCTAACTCCAGGTGCATGAGTGAGATTTTTTTTC
CAAATCTTGTTGGAACTTGAAGAACTTCCCGGGAACAGGGCTGAAAATAACCTTAAGACTCTTAGAAAATGACTGCAGT
GTGGGTGAGAACTGGCAGGCCCCGTCGTGTGCCGCGCTGGGTAGGAGGCTGAAAGTGCAGGCTGAGCGTGCTCGCTCGG
CGGCGGTTCGAGCTCCTTTGCAGCCTCTCATGAATGAACTTCCAGAGTTTTTTTATGAATGGGCGCTCCGTCCTTGAAT
GAACACCAGTGCGCCGCGCTCTGATTGGCCTCGGCGGATAAAGCCACGCCCACTTTCCCCCCAGCGTGCTGCGATTGGT
GGACGCGCCCCAGCCCAGGGCTTCATTCACGAAGTCAATGAAACAAAGGAGCGGGGAGCCGAGCTCGTGAAGGCGGCGA
TGCGCCAATGGGAGGCCGCCCCCGGGCGCTCAACGGCCTGAACGGCCGCGCGGGCGGGGCTGCGTGGGGCTCCGCATGG
GCCGGGAGTCGCCACCGGGTGCGCTCCGAGAGCCGGGAGCTCCGCGGCCGCGGAGGTAGCGCCCGGGCGGCAGGATGAA
GGGGTACGTGGACCAGCAGGTGCCGTTCACTTTCCCTCAGCCGCCGCCGGGCCATGCGGGCTCCGGGTGCCGGACTCCG
ACGGGCGCTGCGAAGAGCCCCATGGAGCCGGGCTTGCTGCCGGCGCAGGATTCGGAAGACCTCTTCCAGGACTTGAGCC
AGTTCCAGGAGACTTGGCTGACAGAAGCTCAGGTTCCAGACAGCGATGAGCAATTTGTGCCTGACTTCCATTCAGAAAA
CCTAGCTTTTCATAGTCCTCCTGCAAAGATTAAAAAGGAACCACAGAGTCCCTCCTCGGACCCCACGCTGTCCTGCAAC
CACAAGCAGCCATTCCAGTACCGCAATGGAGAGCAGTGCCTTTATGCCAGTGCCTATGATCAACCCAGACCGGTTGGGA
TCAAATCCCCTGACCCAGGAACCCCAATCCAGTCACCGCTCCAGCAGTTCCCCAGACAGGACAGGAACTTCCTGACCCC
TTCAGGGCCACCCCACCCCACATCCAGCTGTGGATACCTCATTGAAAACAGCTCTGCCTACCAGCCACCTGTGGAGATG
TGCCACTCCTTCCCCTCCTCCCAGGGCATGGCCCAGGATGCTCCCATCGCCTACCAGCGCCCCATGTCTGAGCAATGCC
TTCAGTTCCCCCCGCAGGGCTTCAAGCAGGAGTTCCATGACCCACAGTATGAGCAGGCGGGCAGCAGCTGCCAGTACCC
AGCAGCCGTGGTCATCAAGCAGGAGCAGGTGGACTACATGTATGACTCAGGCTGCAGCTATGACAAGCAGATGAGGCCC
TTTGCTGACGATGTCTGCGTTGTTCCAGAAAAATTTGAAGCAGGTGACATCAAGCAGGAGGTCGGAGGGTACCGGGAGG
GCCCTCCCTATCAGCGGAGGGGATCTCTCCAGCTCTGGCAGTTCCTTGTGGCTCTATTGGATGATCCCACCAACTCCCA
CTTCATTGCCTGGACTGGAAGAGGGATGGAGTTCAAGCTGATTGAGCCAGAAGAGGTAGCCAGGCTGTGGGGCATCCAG
AAGAACCGGCCAGCCATGAACTACGACAAGCTGAGCCGCTCTCTTCGCTACTATTATGAGAAAGGCATCATGCAGAAGG
TGGCAGGGGAACGCTACGTCTACAAGTTTGTGTGTGAGCCCGAGGCTCTGTTCTCTCTGGCCTTCCCTGACAACCAGCG
GCCGGCCCTGAAGGCAGAGCTGGAGAGGCAGATCAGCGAGGAGGACACGGTGCCTCTGTCCCACCTGGATGAGAGCACT
GCTTACCTGCCTGACCTTGGGAGCCTCCCCCCGCAGCTCTATGGCAAAGGCTACACCTACTAGAGCTGCTGGAGCCGTG
TGCCACCCTGATCGTGTATATAAGGAGATGTCTGGTTAGTAACCAAGCTGTATAGGTGTTTTCCCAGGCCAGCCTGGGG
CTGCACAGAGCTATGATACCTGCTGTGGGCAGGAGAAGGGTTCAGGTCAATGTGTGGTTGGATAACCAGCAGGGGGTCA
ATGGGGCTGCTGGGTGCTGGTGGTGCCAACCCCATATCTGGCAGGATGGGACCACTCCTCAGTGTGAAGTCATCACCTG
AGCAGGGCAGCTGTGGCTTCCCAGCATCACAGGTGGTCGCTGCCTCCAGCAGGAGCCCACCTACAGCATTCCTCCCCCC
TTGGCAGATGTGATGCCATCCTGCTTGGCTTCTTCTCACAGCTGGGGATGCTACAGCTGCTGCTGGCTGCCTTCCTCCA
GTGCTGACCCCCTGGGTATATTGCCCTCAGCCGGGGCAGCCCAGACCTGTGCAGATTCACCTCCTCAGGGCCAACCTTC
TCTTCTGCCCAGGAGAGCTGTGCCATGTGGCTGCAAACCAAATGCCTTCCCCTGAATTGCTCTGTTGGCACTGAGAAGT
GCCTGTCCCGTACGTGCATGCTCCTGCATTGCCACCTCCTTGCCTGCAGCACCTCATGCCAGGGCTGCCACATGTTCTT
GAGCTGGGCAGCTGAAGGTGTGGGCCAGGGTGAGAGCACTCCCACTGTGCATGGCCCTAAAACCAGCACAGGGCAAGCA
CAGAGCTTCCAGATGTGCTGTGCTGGGTATGAGGGGAGTCAAATCAATGTCATAGCCTCTACCACCAGGCCATATGTGT
GGCATGGCTGTTCCAGCCTAGACAAGGGCTAGAACCATCTCTAGGATCTTTGGAGGCTCAGGGACTTGGCTAGAAAATC
ACCTGAGGTGTGAAAAGAACCTGGGGGGGGGGAGGCATTATGAATACACTCTAAAAAGTAACTTAAATCGGAGCTCTTA
ACATCTGAATTCAGACCCAACCTCTGCATGCGTTTACCTCTTTGAAGGAAAGTCTGAAGTGTTGGAAAGGCAGATATCT
CTGCAGCCTGAAGCAGCACTTTAACTGTTTTTCCCCAGTAGTGAACATTTACAGTGGGCACCACATCCCCGGGGAGAGG
TGCTGTGCTTCTTAATTAGCTGCTCCAGCCCAGCGCCCATTGGGGTGAGGAGCTGCGTGGTGAATCTGTACCAAAACAG
CCTCTTTCCTCCTTGACTGAAAGACCCATTCCGTCTGTGCTTCTGCCCTGCAGGGCTGGCAGCAGCCCCTCCTGGGGGG
CTCAGGAGCAGCCCCCTCTGCTGCTGCCTTCTCATGCTCAGCCCTGGGCTTCCAGCCCTGCTGCCTCATCCCACTCTAC
CGCGTGCCTCCACTGCCCCAAAGTGATGGAGAAGGGGAACCCTGCTGTTGGTATAATCTGCCTTTACTATTTATGAGTG
TAAAAAAAATACTATAATTAATAAATTGGTCTATGTCTTTG
CitationBetancur P, Sauka-Spengler T, Bronner M. A Sox10 enhancer element common to the otic placode and neural crest is activated by tissue-specific paralogs. Development. 2011 Sep;138(17):3689-98.
Copyright© 2011. Published by The Company of Biologists Ltd
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (XM_015299450.2). Pea3 is also known as ETV4 in NCBI.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 8
stage 9
stage 11
Central Nervous System
Ear/Otic Placode
 
31-44
stage 44
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.446

Mouse

EmageMGI:99423
EurexpressMGI:99423
MGI GXDMGI:99423

Frog

Xenbase6051132

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-990415-71
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona