Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
RAMP2 Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol RAMP2 Official Full Name receptor activity modifying protein 2 CGNC ID 17380 also known as receptor activity-modifying protein 2|receptor (G protein-coupled) activity modifying protein 2|receptor (calcitonin) activity modifying protein 2 gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id RAMP2.Javerzat.2009 Data Source Publication Complete cDNA Template Probe show CCGGCAGGATGGCACCGTGTGCGCAGATGGGCTCTGGCCACCTCTCCCGAGGGCTCCTGCTGCTCTGTGCACTGCTGGG
Citation Javerzat S, Franco M, Herbert J, Platonova N, Peille AL, Pantesco V, De Vos J, Assou S, Bicknell R, Bikfalvi A, Hagedorn M. Correlating global gene regulation to angiogenesis in the developing chick extra-embryonic vascular system. PLoS One. 2009 Nov 17;4(11):e7856.
Copyright Copyright Javerzat et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_001105610.1).
Stage Image (click image to view full size) Location (click to highlight) Comments (click to highlight) 1-3
stage 1
31-36 stage 36
Veins
Data from NCBI Unigene EST ProfileGga.12104
Mouse Frog Fruit Fly Zebra Finch Zebrafish
