GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

RBP4A
retinol binding protein 4 A, plasma

Gene
Official SymbolRBP4A
Official Full Nameretinol binding protein 4 A, plasma
CGNC ID49682
also known asRBP, RBP4, retinol-binding protein 4|PRBP|plasma retinol-binding protein|retinol binding protein 4, plasma
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205238
PolypeptideNP_990569
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4126
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human5950ENSG00000138207MIM:180250MIM:180250
Mouse19662ENSMUSG00000024990All phenotypic alleles (6):Targeted, knock-out(3) Targeted, other(3) MGI:97879
Xenopus548465, 3977055841607
Zebrafish100334989, 30077ENSDARG00000077505ZDB-GENE-000210-19ZFIN:ZDB-GENE-000210-19
Gene Ontology
Molecular Functionprotein binding, protein domain specific binding, receptor binding, retinal binding, retinol binding, more...retinol transporter activity
Biological Processcardiac muscle tissue development, embryonic organ morphogenesis, more...embryonic retina morphogenesis in camera-type eye, embryonic skeletal system development, female genitalia morphogenesis, gluconeogenesis, glucose homeostasis, heart trabecula formation, lung development, maintenance of gastrointestinal epithelium, negative regulation of cardiac muscle cell proliferation, oocyte growth, positive regulation of immunoglobulin secretion, positive regulation of insulin secretion, protein complex assembly, response to estrogen, response to retinoic acid, response to virus, response to vitamin A, retinol metabolic process, retinol transport, urinary bladder development, uterus development, vagina development
Cellular Componentclathrin-coated vesicle, extracellular space, yolk, yolk plasma
Links to other databases
Entrez Gene396166
Ensembl GeneENSGALG00000006629
KEGGgga:396166

Entry 1

GEISHA IdRBP4.Alev.2010Data SourcePublication
Complete cDNA Template Probeshow
GGACAGGATGGCCTACACATGGAGAGCTCTGCTGCTGCTGGCGCTGGCCTTTCTGGGCAGCAGCATGGCAGAGCGGGAC
TGCCGTGTGAGCAGCTTCAAAGTCAAGGAGAACTTCGACAAGAACAGGTACAGTGGCACCTGGTACGCCATGGCAAAAA
AAGATCCTGAGGGGCTGTTTCTACAGGACAATGTGGTTGCCCAGTTCACTGTAGATGAGAATGGACAGATGAGTGCCAC
TGCAAAGGGCAGAGTCAGACTCTTCAATAACTGGGATGTCTGTGCTGATATGATTGGCTCTTTCACTGACACAGAGGAT
CCTGCCAAGTTCAAGATGAAGTACTGGGGTGTTGCCTCTTTTCTGCAGAAAGGAAATGATGATCACTGGGTAGTGGACA
CAGATTACGATACATATGCTCTTCATTATTCCTGCCGTGAGCTAAATGAAGATGGCACTTGTGCTGA
CitationAlev C, Wu Y, Kasukawa T, Jakt LM, Ueda HR, Sheng G. Transcriptomic landscape of the primitive streak. Development. 2010 Sep 1;137(17):2863-74. Epub 2010 Jul 28.
CopyrightPublished by The Company of Biologists 2010. This material is protected by a copyright retained by the authors. Permission granted by Dr. G Sheng.
CommentsAuthors indicated FORWARD PRIMER GGACAGGATGGCCTACACAT REVERSE PRIMER TCAGCACAAGTGCCATCTTC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Area Opaca
Epiblast
caudal

Entry 2

GEISHA IdRBP.Barron.1998Data SourcePublication
Complete cDNA Template Probeshow
CGGAGCTGTCTGGACAGGATGGCCTACACATGGAGAGCTCTGCTGCTGCTGGCGCTGGCCTTTCTGGGCAGCAGCATGG
CAGAGCGGGACTGCCGTGTGAGCAGCTTCAAAGTCAAGGAGAACTTCGACAAGAACAGGTACAGTGGCACCTGGTACGC
CATGGCAAAAAAAGATCCTGAGGGGCTGTTTCTACAGGACAATGTGGTTGCCCAGTTCACTGTAGATGAGAATGGACAG
ATGAGTGCCACTGCAAAGGGCAGAGTCAGACTCTTCAATAACTGGGATGTCTGTGCTGATATGATTGGCTCTTTCACTG
ACACAGAGGATCCTGCCAAGTTCAAGATGAAGTACTGGGGTGTTGCCTCTTTTCTGCAGAAAGGAAATGATGATCACTG
GGTAGTGGACACAGATTACGATACATATGCTCTTCATTATTCCTGCCGTGAGCTAAATGAAGATGGCACTTGTGCTGAT
AGCTATTCCTTTGTATTCTCCCGGGACCCCAAGGGATTGCCTCCAGAGGCACAGAAAATTGTTAGACAAAGGCAGATAG
ACCTCTGCTTGGACAGAAAATACAGAGTTATCGTTCATAATGGATTTTGCTCTTAAGGAGATCCATAAGTATGGAAGGA
AACCGTGTAACAGTACCATGG
CitationBarron M, McAllister D, Smith SM, Lough J. Expression of retinol binding protein and transthyretin during early embryogenesis. Dev Dyn. 1998 Jul;212(3):413-22.
CopyrightCopyright © 1998 Wiley‐Liss, Inc.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Barron al. 1998. RBP is also known as RBP4A in NCBI.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Early Endoderm
 
7-12
stage 8
stage 10
Endoderm
 
31-44
stage 44
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4126

Mouse

EmageMGI:97879
EurexpressMGI:97879
MGI GXDMGI:97879

Frog

Xenbase5841607

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-000210-19
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona