GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

RFX3
regulatory factor X3

Gene
Official SymbolRFX3
Official Full Nameregulatory factor X3
CGNC ID53056
also known astranscription factor RFX3|regulatory factor X, 3 (influences HLA class II expression)
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003642990
PolypeptideXP_003643038
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene427351
Ensembl GeneENSGALG00000010179
KEGGgga:427351
GEISHA IdRFX3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGTTCAGTATGTGGAAGGAAGCGAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGAGGTGGAGTAGAGGGAGAATAGCGcDNA Template Length1023
Forward cDNA Template Probeshow
CCCANAAAGGTTTGCCACAACTTTTCTATCAGGGGCTGGAATTGAAGAATTCACTACCACATCCAGAATTGCCTCACAG
TGCTCTCGATAAAGACTCTGCAGTGATTTGATGTCCTCAAAGGTAGTACCATCTGGTAGAGAAGATATTTCAACTTCAC
CAAACTCTGGAAGTACTCGAGACGCATCTAAAAACTGCTGATGATGTTGACTTTGGGCAATTACAGTTTGTTCAACAGA
TGTGCCTGTCTGTTGACCACTTCCTGTGAAGCCATCTGCAACTCCATCCACTTTCTGCATAGGCTTATACCTCTGTTTC
TGCTGCATGGGCTGCTGTCTCATAGCCATATATTGCATGTCCTCTTGTAGTCGATTAAGAGGAGAATCTGGCTTGACAC
GAATCCCATAGTAATGGTATTTGGAGTTCCCCCTAGTTCCAAGTCTTCTTGTCCGTAACCCCATGAAGATTGACCGTAT
GAGTTTTCCAAAGGAGGCTGCATTGACTGGATCCAACTTGTGCTCCTGACAGTGTCGTAAGTAATGGTTGTAAAGGGTA
CTTCTAGGGAGGCTCACTCCTTCTGCAGTTTCATAATTGTCCAAAAGCCACTGAAGATGGCTGTTGAGAAGAGAGCTTC
TGTGAGTGGACAGACCATCAGACTTTTGCAGTGTCTCAATCGCCATTTCAATTGTAGCTGGGGAAGTCCGTGTTGTATG
AGTCACTGAATGACCAGAATTTTCCATTGAATTGCCAATCAAATAGGTCCCTCCTGAGCTGCTAATGAGTTGTCCTCCT
GTGACACCCATCTGAATCCCTCCAGTGCCCACCATGCTATGANAGGAGACCACTGTTGTCACTTGCGCCGAACTTCCTT
GAGTATCAAAATAATTTCCCCCAGTGTTTTGGCTGTACATCTGGGTNTCTGTGTAAGGATAAATTTGTTGATCGGAATA
NCTCCATTANTGTAAACTGTGTCNCTTCCTTCC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Unlabeled
 
7-12
stage 8
stage 8
stage 8
stage 9
stage 10
Anterior Intestinal Portal
Extraembryonic
Forebrain
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Primitive Streak
Somites
 
13-18
stage 17
stage 18
Neural Plate/Tube
Spinal Cord
 
19-24
stage 22
stage 23
stage 23
stage 23
stage 24
Endoderm
Eye
Gut
Leg Mesenchyme
Neural Plate/Tube
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Wing Mesenchyme
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona