GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

RB1
retinoblastoma 1

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolRB1
Official Full Nameretinoblastoma 1
CGNC ID12759
also known asretinoblastoma-associated protein|p104|pRb|rb|retinoblastoma 1 (including osteosarcoma), retinoblastoma 1 , RB1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204419
PolypeptideNP_989750
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2986
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human5925ENSG00000139687MIM:109800MIM:614041
Mouse19645ENSMUSG00000022105All phenotypic alleles (22):Targeted, knock-out(10) Targeted, other(12) MGI:97874
Xenopus1004931141018164
Zebrafish777733ENSDARG00000006782ZDB-GENE-040428-1ZFIN:ZDB-GENE-040428-1
Gene Ontology
Molecular FunctionDNA binding
Biological Processcell cycle, chromatin modification, regulation of cell cycle, more...regulation of transcription from RNA polymerase II promoter, transcription, DNA-templated, viral process
Cellular Componentnucleus
Links to other databases
Entrez Gene386582
Ensembl GeneENSGALG00000016997
KEGGgga:386582

Entry 1

GEISHA IdRetinoblastoma.Wagner.2001Data SourcePublication
Complete cDNA Template Probeshow
GAATTCTCTTGGTGTTGTAGCCTCAAATGGATTACCAGAGGTTGACGTTCTCTCAAAACAATATGATGAGCTTTATCTC
AAAAACAAAGATATAGATGCAAGATTATTTCTGGATCATGATGAAACTCTACAGCCTGATGTTATAGCATGCTCACAGT
TGGAAAGAACACCACGAAAAAATAACCCAGATGAGGAGGTTAATCATGTACTTCCACAGACTCCTGTTCGAGCTGCAAT
GAATACTATTCAGCAGTTGATGATGATTTTGAACTCAGCAACTGATAAACCATCAGATACTCTCATTGCATATTTCAAT
AATTGCACAGTGAACCCTGAAGACAGCATCCTGAAAAGAGTAGAAAGTCTTGGCCACATCTTCAAAAAGAAATTTGCTG
AAGCAGTTGGACAGGGATGTGCTGAGATTGGCTCACAGAGATACCAGCTTGGAGTACGGCTGTATTACAGAGTAATGGA
GTCTATGCTGAAGTCGGAAGAAGAGCGCCTCTCAGTGCACAATTTTAGCAAACTTCTGAATGATAACATCTTCCACACA
TCTCTTCTGGCATGTGCTCTTGAAATTGTCATGGCTACCTATGGCAGAACTGCTTCACAAAGTGATGGTACCAGTGCTG
AAACAGACTTGTCTTTCCCATGGATTCTCAACGTATTTGATTTAAAAGCTTTTGACTTCTACAAGGTGATTGAAAGTTT
CATTAAAGTGGAGCCAAGCCTAACGAGGGACATGATAAAGCATCTAGAACGCTGTGAACATCGCATTATGGAATCTCTT
GCTTGGCAATCTGATTCACCTCTGTTCGATCTTATCAAGCAGTCAAAAGAACGAGAAGGTCAGACCGATCAGCCTGAGC
CCACTTCCACCCTAAATCTGCCTCTCCAGCACAACCACACTGCAGCAGATCTGTATCTTTCTCCTGTGAGATCTCCTAA
GAAGAAAGCATCTGGACACCCTCAAAGTGGTACTTCTAATCCAGATGCTCAGCCATCTGCGACCTCACAAACACAGAAG
CCACAGAAATCTACCTCCCTCTCTCTGTTCTACAAAAAAGTGTTTCGACTGGCCTATCTTCGATTGCATACCCTGTTCT
TTCGGCTTCTCTCCGAACATCCTGACCTGGAGCCGTTGATCTGGACCCTCTTCCAGCACACACTGCAAAATGAGTCTGA
GCTTATGAGAGACAGGCACTTGGACCAGATCATGATGTGTTCCATGTATGGCATATGCAAAGTAAAGAATGTGGATCTT
AGATTTAAAACAATAGTTTCTGCATACAAAGAGCTGCCCAATACAAATCAAGAGACTTTCAAACGTGTTCTTATCAGGG
AAGAGCAGTACGACTCCATTATAGTCTTCTACAACTTAGTGTTCATGCAGAAGCTGAAGACAAACATCCTGCAGTATGC
CTCCAACAGGCCTCCTACGCTGTCACCTATCCCACACATTCCTCGCAGCCCCTACCAGTTTTCCAATTCTCCTCGGCGT
GTCCCTGCGGGCAATAACATCTACATCTCACCCTTGAAGAGCCCTTACAAGTTCTCTGATGGGTTTCATTCTCCCACAA
AGATGACTCCGAGGTCCAGAATTCTGGTGTCAATTGGTGAAACGTTTGGGACTTCTGAAAAGTTTCAAAAAATAAACCA
GATGGTGTGCAAC
CitationWagner M, Miles K, Siddiqui MA. Early developmental expression pattern of retinoblastoma tumor suppressor mRNA indicates a role in the epithelial-to-mesenchyme transformation of endocardial cushion cells. Dev Dyn. 2001 Mar;220(3):198-211.
CopyrightCopyright © 2001 Wiley-Liss, Inc.
Commentsno expression reported at stage 14 or below.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
stage 16
stage 17
stage 17
stage 18
stage 18
Endocardium
isolated heart

Entry 2

GEISHA IdRB.Marx.2010Data SourcePublication
Complete cDNA Template Probeshow
AGCGGAGCCCCTTGGTGGCCGCTTGTACGGCGGGGGCCCGACGGTCACCATGCCGCCCAAGCCCCTTCGCAGGGCGGGC
GCCGCCAGGAGTCAGCGCACCAGCCCCGAGGGCGGCGCCGGCACCGCCTCACCGCCCGGCGGCACCCGGCTGGAAGTGG
GGGAAGCGGAGTTCGTGGCTCTGTGCGATGCGCTGAAGGCGCCGGACAGCGTGAGGGAGAAGGCCTGGATGACGTACCA
GAGCTTGGCGGCCGCCGACGGGGCTTCGGCTTATAACAAAAAGAAGAAGGAAACATGGGGAGTCTGTATCTTTATTGTA
GCAATTGATCTGGATGAAATGACATTCACTTTTACAGAGCTGCTGAAAAGTTTAAGCATAAGCGTGTGCACATTTTTTC
AGTTTCTCAAAGAGGTGGATGTTAACATGGATACTGTAAGCACTAAAGTTGATAGCACTGTATCAAGGCTGAAAAAGAA
ATACGATGTCTTACTTGCACTGTATCACAAGTTCGAAAGGACTTGTGGCCTTATTTATCTGGAGCAACCCAGTAGTGAG
ATTTCTGCTGAACTCAGTTCTGTATTAGTCCTAAAAAATTACTGGATTACTTTTTTGCTGGCAAAAGGTAAAGTGTTGC
AAATGGAAGATGACCTCGTGATCTCTTTCCAGTTGTTGCTGTGCGTCTTAGATTATTTTATCAAACTGTCACCTCCTGC
TATGCTCAAGGAACCATACAAGTCTGCTGTGACTGCACTGACTGTTAATGGTTCAACTCGAACCCCACGAAGAGGTCAG
AACAGGAATGCACGCGCTTCAAAGCAAATTGATACAGATACAAAAGTTATTGAAATCCTTTGTAAAGAGCATGATTGTA
ATTTAGACGAGGTAAAAAATGTGTATTTCACAAGCTTTATTCCTTTCTTGAATTCTCTTGGTGTTGTAGCCTCAAATGG
ATTACCAGAGGTTGACGTTCTCTCAAAACAATATGATGAGCTTTATCTCAAAAACAAAGATATAGATGCAAGATTATTT
CTGGATCATGATGAAACTCTACAGCCTGATGTTATAGCATGCTCACAGTTGGAAAGAACACCACGAAAAAATAACCCAG
ATGAGGAGGTTAATCATGTACTTCCACAGACTCCTGTTCGAGCTGCAATGAATACTATTCAGCAGTTGATGATGATTTT
GAACTCAGCAACTGATAAACCATCAGATACTCTCATTGCATATTTCAATAATTGCACAGTGAACCCTGAAGACAGCATC
CTGAAAAGAGTAGAAAGTCTTGGCCACATCTTCAAAAAGAAATTTGCTGAAGCAGTTGGACAGGGATGTGCTGAGATTG
GCTCACAGAGATACCAGCTTGGAGTACGGCTGTATTACAGAGTAATGGAGTCTATGCTGAAGTCGGAAGAAGAGCGCCT
CTCAGTGCACAATTTTAGCAAACTTCTGAATGATAACATCTTCCACACATCTCTTCTGGCATGTGCTCTTGAAATTGTC
ATGGCTACCTATGGCAGAACTGCTTCACAAAGTGATGGTACCAGTGCTGAAACAGACTTGTCTTTCCCATGGATTCTCA
ACGTATTTGATTTAAAAGCTTTTGACTTCTACAAGGTGATTGAAAGTTTCATTAAAGTGGAGCCAAGCCTAACGAGGGA
CATGATAAAGCATCTAGAACGCTGTGAACATCGCATTATGGAATCTCTTGCTTGGCAATCTGATTCACCTCTGTTCGAT
CTTATCAAGCAGTCAAAAGAACGAGAAGGTCAGACCGATCAGCCTGAGCCCACTTCCACCCTAAATCTGCCTCTCCAGC
ACAACCACACTGCAGCAGATCTGTATCTTTCTCCTGTGAGATCTCCTAAGAAGAAAGCATCTGGACACCCTCAAAGTGG
TACTTCTAATCCAGATGCTCAGCCATCTGCGACCTCACAAACACAGAAGCCACAGAAATCTACCTCCCTCTCTCTGTTC
TACAAAAAAGTGTTTCGACTGGCCTATCTTCGATTGCATACCCTGTTCTTTCGGCTTCTCTCCGAACATCCTGACCTGG
AGCCGTTGATCTGGACCCTCTTCCAGCACACACTGCAAAATGAGTCTGAGCTTATGAGAGACAGGCACTTGGACCAGAT
CATGATGTGTTCCATGTATGGCATATGCAAAGTAAAGAATGTGGATCTTAGATTTAAAACAATAGTTTCTGCATACAAA
GAGCTGCCCAATACAAATCAAGAGACTTTCAAACGTGTTCTTATCAGGGAAGAGCAGTACGACTCCATTATAGTCTTCT
ACAACTTAGTGTTCATGCAGAAGCTGAAGACAAACATCCTGCAGTATGCCTCCAACAGGCCTCCTACGCTGTCACCTAT
CCCACACATTCCTCGCAGCCCCTACCAGTTTTCCAATTCTCCTCGGCGTGTCCCTGCGGGCAATAACATCTACATCTCA
CCCTTGAAGAGCCCTTACAAGTTCTCTGATGGGTTTCATTCTCCCACAAAGATGACTCCGAGGTCCAGAATTCTGGTGT
CAATTGGTGAAACGTTTGGGACTTCTGAAAAGTTTCAAAAAATAAACCAGATGGTGTGCAACAGCGAGAGCCACGTAAA
GCGCAGTGCGGAGCCCAGCGATGCCCCCAAGCCACTGAAGAGGCTGCGCTTCGATATAGAAGGGCAGGACGAGGCAGAT
GGAGGCAAACACCTTCCCCAGGAGTCCAAGTTCCAACAAAAGCTTGCAGAAATGACATCTACTCGAACAAGAATGCAGA
AGCAGAAACTGAATGATGGAAACGATACCTCAGCCAACGAAGAAAAGTGAGATTCTCCTCAGGACCAGGGGCTGCTGCA
GGCCCTCCCAGCTTTTGTTTTACTGCCTTCATTCACTGAGTTGCTTCTTCAGTCGCTTTTATCCCAAACCAATAGTTGA
AAACCCTTGGACTTTATTTTCTTCAAGGTTTTTCACGATACTTTGCCTTATGATGTAGCATGTATGCGATGTAAGCCAC
TGAATTTAATTTATATATTTTCGGGGGATTTTAAAAAGCAGCTTGGGAAGTGTCTTAGTTTGCTATTGCAGCGTTACTG
ATTGAAGCCAGTTCAATCTACCTGGATTGAATATTTTCTGTCTCAAGACAAAACGTTAGCTAGGGATCTGAAGTGCACT
AATTTTACTTCTTAGATTTCATTTTAATGTCGGATCTCAAAGCATTATTTGCAAGTATTGAAAATGAGGGGTCAGATGC
CGCAAGGATTTCTGTCTCTGTGTGTAATTAACACATCCAATTCCCATTAACTTAGCTGCACAGCAGCCGTGCAGGGTCA
GGCTCTCCCCGCAGAAGCAGGAAGCAGTGAGCACGTCGTGTTAGCGGTACTACTGAAAGCAGTGAGCTGTGCTGCACCT
CAGGTACGTCCCGTTCTGCAGTCCCCCAGCTCTCACCCCACACATTTCAGAGGGCCCACGTTGAATTTCATTGAATCTC
ACAGAGGTTGAGTCCCACGAAGCAAAAAGGCGCATTCCCAAATGCAAAGTACCACGTTGTGCACTTTCGTATCTCGGAA
AACCTCGATTTAAGAAAACACAAAGTAGAACACCCCCAACCTACATCACACCTCGCACACAGAAGATGGCAAAGGTCTC
ACAATGTAGGATTCTCTTGAAGTGATTTCTACAGGTGTCCATGTGGCCGAACGTCACAGCACGAAGCTGTGTGCCTGAG
GCGGTGCCTTACCCAAAAGGCAGAGCTCAATGGGCAACTTGGGAGCAAACGTTTTTAAGTGTATTTATAAGTTATGGAC
TCAGATAGTGGATTTTTTTTTTCTTGCAGTGATAAAAGGTCTGCAGAATAGCCAGCTAAGAAAAGGGTGTTTTGTTTCT
AGTGAACTAAATACAATAAATGAGGTGCCACGTTTTTAAATGACCCATTTTAATGAAATCTAGCTCATGCAGCTGCTTA
AATCAGATGAGTTAGGGTAGCAAAGCATGCTGCTCATTACACAGTAACACTTCTCCGCATAGGAGGTGTTTAGAAATGG
TGTAGTGAACCTAGAATGCCTACAGTAGTACCCGCTGAGGACCAGTTCTGGTGTTGACCAAAAGCTGAACCTGGAGGTA
CAGAAACCTCCACAAACGGCACACGGATTGGTCACTGAATTGTAAAATGAGATTATTTTTTTATTCTCAGTACGGCTTC
AACTTTCATCCCGAAGAATGTACAGAAGTGTTAAGAGTACACAACGTTTATTTTTTCACTTTCAACAGAGTTTTACAGA
CAGAATGTGTGTTGCATTGGGGCTCGCTGGTCCCAAGCTCTGTTACAGCAGCTGAAGTTCTTCGGTGACCCTCGGGTGA
GAGCGCTGCAGGCGCGACACGGCAGAGCCCCGCACCTAACAGATCTCCTAGCGCCTGACTGGGACACTGTGTTTGTTCG
TTCCAACAGACCGAAGGCTTTACATCAAATGTATGGCAAT
CitationMarx M, Lebuhotel C, Laugier D, Chapelle A, Calothy G, Saule S., Down regulation of pRb in cultures of avian neuroretina cells promotes proliferation of reactive Müller-like cells and emergence of retinal stem/progenitors. Exp Eye Res. 2010 Jun;90(6):791-801. Epub 2010 Apr 7.
CopyrightCopyright © 2012 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204419.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 29
Retina
 
31-38
stage 35
stage 38
stage 38
Retina
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2986

Mouse

EmageMGI:97874
EurexpressMGI:97874
MGI GXDMGI:97874

Frog

Xenbase1018164

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040428-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona