GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SIX3
SIX homeobox 3

Gene
Official SymbolSIX3
Official Full NameSIX homeobox 3
CGNC ID49119
also known asCSIX3, homeobox protein SIX3|sine oculis homeobox homolog 3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204364
PolypeptideNP_989695
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.291
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular FunctionDNA binding, more...RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity, sequence-specific DNA binding
Biological Processbrain development, eye development, negative regulation of transcription, DNA-templated, more...negative regulation of Wnt signaling pathway, regulation of transcription from RNA polymerase II promoter, transcription from RNA polymerase II promoter
Cellular Componentnucleus
Links to other databases
Entrez Gene378786
Ensembl Gene
KEGGgga:378786

Entry 1

GEISHA IdSIX3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCCCATTTCTTCCTGCCCAAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGTGCTGGAGCCTGTTTTTAGCCcDNA Template Length727
Forward cDNA Template Probeshow
TCCTGTAAAGGTCCTGCCGGTTCCGCACCCGCTGGACGCTGCAAGTCCTCTCCTTGAAGCAATGCGTCTTCTGCTCACC
ATCCCAAATGGGCCTGGGCAGCGGAAACTTCTTCCTCACCCTGTATTTATCAACCGGCCCCAGCGGGCGGCCCCGCATT
TTCTCAGCCTCCTGGTAGAGCGCTTCGAGCGACATGGCCTGCAGCTTGCCGTGCGACTCCTTGGTGAATTTGTGGTTCT
CCAGGATGTGGTAAAGGCCACGGAAATTGCCCTTGTGGAAGGTCACCACCGCCCGGGCGCGCAGGATGGATTCATGCTT
GTTGAAGGCCTCCCATGCCCCCGGCCCCACCGACAAACGACCAGAGGAACCTCCCCAGCCTTTCTATTTCTCCGGTCCC
CTACAGCGTCCCGAACACCCTGCCAACTTGCTCCGGGGAGAAATTTACAGGGCGCACCTAAAACTTTTAATAAGTCTTT
AATACAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGGCTGGGGAGGTTCCTCTGGTCG
CTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCGCACGGGCGGTGGTGGCCTTCC
ACACGGGCAACTTCCGCGACCTCTACCACATCATGGAGAACCACAAATTCACCAAGGAGTCGCACGGGCAGCTGCAAGC
CATGTGGCTCCAAGCGCACTAACAGGAGGCCGACAAGCTGCGGGGCCGCCCACTGGGGCCGATTGATAAATACAGGGTG
AAGAAGAAATTTTCGCGGCCCAGGACCTTTGGGATTGCCAGCAAAAACCCCCTGCTTCACGAGAGGACTCCCAACCTCC
TAAGGGATTGATACTTGCCGGACCCTTACCCCATCCAGCCGNAAAGGGAAATAGCCCAGGCCACGAGGTTCCCCCGGCG
CCGTAGGCCGTGGTTCCAAACCAAAGCCAAAACCCACCCCCGCCCCCTAAACCAGCTCCCCAATTTATGGGGGAATAAT
AA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 5
Early Endoderm
Early Mesoderm
Epiblast
 
7-12
stage 8
stage 8
stage 8
stage 9
stage 9
stage 9
stage 12
Eye
Forebrain
Foregut
Head Mesenchyme
Lateral Plate Mesoderm
 
13-18
stage 13
stage 17
stage 18
Eye
Face Mesenchyme
Forebrain
Foregut
Nasal Placode/Nerve
Oral Pharynx
Pharynx
 
19-24
stage 22
stage 23
stage 24
Eye
Forebrain
Hindbrain
Nasal Placode/Nerve
Oral Pharynx
 

Entry 2

GEISHA IdSix3.Chapman.2002Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationChapman SC, Schubert FR, Schoenwolf GC, Lumsden A. Analysis of spatial and temporal gene expression patterns in blastula and gastrula stage chick embryos. Dev Biol. 2002 May 1;245(1):187-99.
Copyright2002 Elsevier Science (USA). All rights reserved.
CommentsNo mapping for this gene on the present genome build
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 6
Endoderm
Hypoblast
Neural Plate/Tube
Chordin:red
Double labeled

Entry 3

GEISHA IdSix3.Ohuchi.2007Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationOhuchi H, Hayashibara Y, Matsuda H, Onoi M, Mitsumori M, Tanaka M, Aoki J, Arai H, Noji S. Diversified expression patterns of autotaxin, a gene for phospholipid-generating enzyme during mouse and chicken development. Dev Dyn. 2007 Apr;236(4):1134-43.
CopyrightCopyright © 2007 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204364).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
Eye
Telencephalon
 

Entry 4

GEISHA IdSix3.Abe.2006Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationAbe Y, Chen W, Huang W, Nishino M, Li YP. CNBP regulates forebrain formation at organogenesis stage in chick embryos. Dev Biol. 2006 Jul 1;295(1):116-27. Epub 2006 Apr 19.
CopyrightReprinted from Developmental Biology, 295, Yoko Abea, Wei Chena, Wei Huangc, Mizuho Nishinod and Yi-Ping Li, CNBP regulates forebrain formation at organogenesis stage in chick embryos, 116-127, Copyright 2006, with permission from Elsevier. Copyright © 2006 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #NM_204364).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19
stage 19
Forebrain
 

Entry 5

GEISHA IdSix3.Chapman.2008Data SourceDirect Submission
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
Comments Images Provided by Susan Chapman.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 5
stage 5
stage 6
Forebrain
Neural Plate/Tube
Chd:red
Double labeled
Six3:blue
7-12
stage 7
stage 7
stage 7
stage 8
stage 9
stage 9
stage 11
Forebrain
Neural Plate/Tube
 
13-14
stage 14
Eye
Forebrain
 

Entry 6

GEISHA IdSIX3.Halilagic.2007Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationHalilagic A, Ribes V, Ghyselinck NB, Zile MH, Dollé P, Studer M. Retinoids control anterior and dorsal properties in the developing forebrain. Dev Bio 2007 Mar 1;303(1):244-58
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204364.1). Images are quail, but sequence and map shown are chick.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19
stage 19
stage 19
Eye
Nasal Placode/Nerve
quail embryo

Entry 7

GEISHA IdSIX3.Merchan.2011Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationMerchán,P, Bardet, SM, Puelles, L, Ferran, JL, Comparison of Pretectal Genoarchitectonic Pattern between Quail and Chicken Embryos. Front Neuroanat. 2011; 5: 23. Prepublished online 2010 December 29. Published online 2011 April 5
CopyrightCopyright © 2011 Merchán, Bardet, Puelles and Ferran.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #NM_204364.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-28
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 28
stage 28
stage 28
stage 28
stage 28
Diencephalon
Midbrain
Quail

Entry 8

GEISHA IdSIX3.Sanchez-Arrones.2012Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationSanchez-Arrones L, Stern CD, Bovolenta P, Puelles L. Sharpening of the anterior neural border in the chick by rostral endoderm signaling. Development. 2012 Mar;139(5):1034-44.
CopyrightPublished by The Company of Biologists © 2012.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_204364.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 5
stage 6
stage 6
Epiblast
Neural Plate/Tube
Control embryo
DLX5(purple)
SIX3(brown)
control embryo: stage 5+/6
control embryo: stage 5+/6
double-labeled in situ:

Entry 9

GEISHA IdSIX3.Reza.2007Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationReza HM, Urano A, Shimada N, Yasuda K. Sequential and combinatorial roles of maf family genes define proper lens development. Mol Vis. 2007 Jan 16;13:18-30.
CopyrightThis is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_204364.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 16
stage 16
Eye
 

Entry 10

GEISHA IdSix3.Reza.2002Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationReza HM, Ogino H, Yasuda K. L-Maf, a downstream target of Pax6, is essential for chick lens development. Mech Dev. 2002 Aug;116(1-2):61-73.
CopyrightCopyright © 2002 Elsevier Science Ireland Ltd. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_204364.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
Eye
 

Entry 11

GEISHA IdSIX3.Ferran.2007Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationFerran JL, Sánchez-Arrones L, Sandoval JE, Puelles L. A model of early molecular regionalization in the chicken embryonic pretectum. J Comp Neurol. 2007 Dec 1;505(4):379-403.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_204364.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
stage 18
stage 18
Diencephalon
Head Mesenchyme
Hypothalamus
Mesencephalon
Double labeled: SIX3, in situ hybridization(blue), PAX3, immunoreaction(brown).
19-24
stage 23
stage 23
stage 23
stage 23
stage 23
Diencephalon
Mesencephalon
Midbrain
 
25
stage 25
Diencephalon
 

Entry 12

GEISHA IdSIX3.Hirashima.2008Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationHirashima M, Kobayashi T, Uchikawa M, Kondoh H, Araki M. Anteroventrally localized activity in the optic vesicle plays a crucial role in the optic development. Dev Biol. 2008 May 15;317(2):620-31. doi: 10.1016/j.ydbio.2008.03.010. Epub 2008 Mar 20.
CopyrightCopyright © 2008 Elsevier Inc. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_204364.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
stage 11
Eye
 

Entry 13

GEISHA IdSIX3.Yuan.1999BData SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGAGCGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCC
GCGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTC
CCTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTA
TCCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGC
AGCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTC
AGCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAG
GCTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGC
GCCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGG
AGTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGG
GCCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGC
TTCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAAC
TGGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAACTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGC
GGCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCAC
AGCTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGCGTCTCCAGTTTGACAGAAAGAGCCGAGACGGGCA
CCTCCATCCTCTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAA
CAACAACAA
CitationYuan S, Schoenwolf GC. Reconstitution of the organizer is both sufficient and required to re-establish a fully patterned body plan in avian embryos. Development. 1999 Jun;126(11):2461-73
CopyrightGreat Britain © The Company of Biologists Limited 1999
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_204364.2).
no images

Entry 14

GEISHA IdSix3.Hsieh.2002Data SourcePublication
Complete cDNA Template Probeshow
GCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGGCCGGTTGA
TAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCTTCAAGGAG
AGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACTGGCTCAGG
CCACGGGGCTCACCCCCACGCAAGTAGGCAACTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCGGCTAAAAA
CAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACAGCTCGGCC
GAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGCGTCTCCAGTTTGACAGAAAGAGCCGAGACGGGCACCTCCATCC
TCTCGGTAACCTCCAGCGACTCGGAATGTGATGTATG
CitationHsieh YW, Zhang XM, Lin E, Oliver G, Yang XJ. The homeobox gene Six3 is a potential regulator of anterior segment formation in the chick eye. Dev Biol. 2002 Aug 15;248(2):265-80.
Copyrightcopyright © 2002 Elsevier Science (USA)
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Hsieh et al. 2002.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 14
stage 14
Diencephalon
Ectoderm
Eye
Hindbrain
Lens
Nasal Placode/Nerve
Retina
pigmented epithelium
pigmented epithelium, prechordal plate
19-24
stage 23
stage 24
stage 24
Lens
Retina
corneal epithelium, ciliary margin
pigmented epithelium
25-30
stage 29
stage 29
Eye
Lens
Retina
ciliary margin
ganglion cell layer
31-44
stage 36
stage 42
stage 44
stage 44
Retina
ganglion cell layer
outer nuclear layer, , inner nuclear layer, ganglion cell layer

Entry 15

GEISHA IdcSix3.Bovolenta.1998Data SourcePublication
Complete cDNA Template Probeshow
GGCGGCGCGGGGCCGGGCGCGTGTGACGCGTGAGTGTGTGCGTGAGTGTGTGCGCGTGTGTGTGCGTGCGTGTGCCCCG
CGCCTCTATGTGGCTGCGTGTGCGTGTGCGGGTGTGGATGCGTGCGCGGTGCGGGTGCCCTTTCCTCCCTTCTTCCTCC
CTTTCTTTCTTTTCTCCGTGATCGCTCTCCCCCTCTCCCCGGTCATCCCATGGTGTTCAGGTCCCCGCTAGAGCTCTAT
CCCACCCATTTCTTCCTGCCCAACTTCGCCGCCGACCCGCACCACCGCTCCCTCCTTCTCGCCAGCGGCGGCAGCGGCA
GCGGCTCGGGCTGCAGCCCCGGGGCCGGCGGCGGCGGCGGCAGCTCCCGGGCGCCCCACGAAGAGTTGTCAATGTTTCA
GCTGCCCACGCTCAACTTCTCCCCGGAGCAAGTGGCCAGCGTCTGCGAGACGCTGGAGGAGACCGGAGACATAGAGAGG
CTGGGGAGGTTCCTCTGGTCGCTGCCGGTGGCGCCGGGGGCATGCGAGGCCATCAACAAGCACGAGTCCATCCTGCGCG
CCCGGGCGGTGGTGGCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTGGAGAACCACAAATTCACCAAGGA
GTCGCACGGCAAGCTGCAGGCCATGTGGCTCGAAGCGCACTACCAGGAGGCCGAGAAGCTGCGGGGCCGCCCGCTGGGG
CCGGTTGATAAATACAGGGTGAGGAAGAAGTTTCCGCTGCCCAGGACCATTTGGGATGGCGAGCAGAAGACGCACTGCT
TCAAGGAGAGGACTCGCAGCCTCCTGAGGGAGTGGTACCTGCAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAACT
GGCTCAGGCCACGGGGCTCACCCCCACGCAAGTAGGCAATTGGTTCAAAAACCGAAGGCAAAGAGACAGAGCGGCGGCG
GCTAAAAACAGGCTCCAGCACCAGGCGATAGGACAGAGCGGCATGCGGTCGTTGGCAGAGCCCGGCTGCCCGACGCACA
GTTCGGCCGAGTCCCCGTCCACGGCGGCCAGCCCGACCACCAGTGTTTCCAGTTTGACAGAAAGAGCCGAGACGGGCAC
CTCCATCCTTTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATATCGGAAAACAAACAAACAAACAAATCACAAC
AACAACAACAAAAGAAAAA
CitationBovolenta P, Mallamaci A, Puelles L, Boncinelli E. Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors. Mech Dev. 1998 Jan;70(1-2):201-3
CopyrightCopyright © 1998 Elsevier Science Ireland Ltd.
CommentsThe complete cDNA template sequence was obtained from the information as described in the publication in Bovolenta et al. 1998.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
stage 6
stage 6
Early Mesoderm
Headfold
Neural Plate/Tube
anterior portion
pcp, prechordal plate
7-12
stage 8
stage 10
stage 11
stage 11
Anterior Neuropore
Eye
Forebrain
Foregut
ov, optic vesicle; fg, foregut; rf, rostral forebrain
ov, optic vesicle; rn, rostral neuropore
rn, rostral neuropore; in, infundibulum; ov, optic vesicle
13-18
stage 13
stage 13
stage 13
stage 13
stage 13
stage 14
stage 14
stage 16
Eye
Forebrain
Lens
Nasal Placode/Nerve
Retina
optic vesicle
in, infundibulum
ppe, presumptive pigment epithelium; lv, lens vesicle; nr, neural retina;
ppe, presumptive pigment epithelium; pnr, presumptive neural retina
ppe, presumptive pigment epithelium; pnr, presumptive neural retina; in, infundibulum; lp, lens placode;
rf, rostral forebrain;op, olfactory pit;
19-24
stage 21
stage 21
Hypothalamus
Lens
Retina
pe, pigment epithelium; nr, neural retina
25-30
stage 27
stage 27
Eye
Hypothalamus
Pineal Gland
Pituitary (Rudiment)
Retina
adenohypophisis
gcl, ganglion cell layer; pe, pigment epithelium
31-44
stage 32
stage 32
stage 32
stage 32
stage 39
stage 44
Eye
Forebrain
Nasal Placode/Nerve
Pineal Gland
Pituitary (Rudiment)
gcl, ganglion cell layer;
inl, inner nuclear layer; gcl, ganglion cell layer;
oe, olfactory epithelium
preoptic area; choroid plexus; stratium
stratium
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.291

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona