GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SMAD6
SMAD family member 6

Gene
Official SymbolSMAD6
Official Full NameSMAD family member 6
CGNC ID5950
also known asMADH6, mothers against decapentaplegic homolog 6|MAD homolog 6|mothers against DPP homolog 6
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204248
PolypeptideNP_989579
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3878
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4091MIM:602931
Mouse17130ENSMUSG00000036867All phenotypic alleles (1):Targeted, other(1) MGI:1336883
Xenopus100492635876705
Zebrafish564395, 116992, 654727ENSDARG00000031763, ENSDARG00000053209ZDB-GENE-011015-1, ZDB-GENE-050419-198ZFIN:ZDB-GENE-011015-1, ZFIN:ZDB-GENE-050419-198
Gene Ontology
Molecular Functionchromatin binding, co-SMAD binding, I-SMAD binding, metal ion binding, R-SMAD binding, more...sequence-specific DNA binding transcription factor activity, transcription regulatory region DNA binding, transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity, type I activin receptor binding, type I transforming growth factor beta receptor binding, ubiquitin protein ligase binding
Biological Processcell-substrate adhesion, immune response, negative regulation of apoptotic process, more...negative regulation of BMP signaling pathway, negative regulation of cell proliferation, negative regulation of pathway-restricted SMAD protein phosphorylation, negative regulation of SMAD protein complex assembly, negative regulation of transforming growth factor beta receptor signaling pathway, response to laminar fluid shear stress, transcription, DNA-templated, transforming growth factor beta receptor signaling pathway, ureteric bud development, zygotic specification of dorsal/ventral axis
Cellular Componentnucleus, transcription factor complex
Links to other databases
Entrez Gene374096
Ensembl Gene
KEGGgga:374096

Entry 1

GEISHA IdSmad6.Lincoln.2004Data SourcePublication
Complete cDNA Template Probeshow
CCAGAGTCTCCGCCGCCTCCCTACTCCCGGCTGTCTCCTAACGACGAGCAAAAGCCACTGGATCTCTCGGATTCCACGT
TGTCTTACACTGAAACAGAGGCGACGAACTCACCCAACGTCACGCCCGGGGAGTTCTCAGACGCCAGCACGTCGCCCGA
TGCCGTGAAGAGGAGCCATTGGTGCAACGTGGCCTACTGGGAGCACCGGACGCGCGTCGGCCGCCTCTACACAGTGTAC
GAACAGTCTGTCAGTATATTTTATGACCTACCTCAAGGAAACGGCTTCTGCCTCGGACAGCTAAACCTGGAAAACAGGA
GCGAGACTGTGAGAAGGACTCGAAGTAAAATCGGTTACGGGATTTTACTTAGCAAAGAACCGGACGGTGTGTGGGCTTA
CAATCGCAGCGAGCATCCCATCTTCGTCAACTCCCCAACACTGGACATCCCCAACTGTAGGACTTTGATAGTGCGCAAG
GTGATGCCGGGCTATTCCATCAAGGTGTTTGACTACGAGAAGTCCTGCCTCTTGCAGCACACTGCAGAGCTGGATTATG
CAGACGGGCCCTACGACCCCAACAGCGTGCGGATCAGCTTTGCCAAGGGCTGGGGGCCGTGTTACTCGAGACAGTTCAT
CACGTCTTGCCCGTGTTGGCTGGAGATCTTGCTCAGTAACAATCGATAACAGTCAGCCTCTGACGAAAG
CitationLincoln J, Alfieri CM, Yutzey KE. Development of heart valve leaflets and supporting apparatus in chicken and mouse embryos. Dev Dyn. 2004 Jun;230(2):239-50.
CopyrightWiley-Liss, Inc. 2004
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 29
Heart
 
31-36
stage 36
Heart
 

Entry 2

GEISHA IdSmad6.Zuzarte.2004Data SourcePublication
Complete cDNA Template Probeshow
GCCACTGGATCTCTCGGATTCCACGTTGTCTTACACTGAAACAGAGGCGACGAACTCACCCAACGTCACGCCCGGGGAG
TTCTCAGACGCCAGCACGTCGCCCGATGCCGTGAAGAGGAGCCATTGGTGCAACGTGGCCTACTGGGAGCACCGGACGC
GCGTCGGCCGCCTCTACACAGTGTACGAACAGTCTGTCAGTATATTTTATGACCTACCTCAAGGAAACGGCTTCTGCCT
CGGACAGCTAAACCTGGAAAACAGGAGCGAGACTGTGAGAAGGACTCGAAGTAAAATCGGTTACGGGATTTTACTTAGC
AAAGAACCGGACGGTGTGTGGGCTTACAATCGCAGCGAGCATCCCATCTTCGTCAACTCCCCAACACTGGACATCCCCA
ACTGTAGGACTTTGATAGTGCGCAAGGTGATGCCGGGCTATTCCATCAAGGTGTTTGACTACGAGAAGTCCTGCCTCTT
GCAGCACACTGCAGAGCTGGATTATGCAGACGGGCCCTACGACCCCAACAGCGTGCGGATCAGCTTTGCCAAGGGCTGG
CitationZuzarte-Luís V, Montero JA, Rodriguez-León J, Merino R, Rodríguez-Rey JC, Hurlé JM. A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 2004 Aug 1;272(1):39-52.
CopyrightReprinted from Developmental Biology, Volume 272, Issue 1, V Zuzarte-Luıs, J.A. Montero, J Rodriguez-León, R Merino, J.C Rodrıguez-Rey, and J.M Hurlé, A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways, Pages 39-52, Copyright 2004, with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
CommentsFragments of chicken Smad6 (702 bp) ... ... genes were obtained by RT-PCR. cSmad6, 5′-AGTACAAGCCACTGGATCTGTCCGA-3′(sense) and 5′-CCAGCCCTTGGCGAAGCTGATGC-3′ (antisense)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
Unlabeled
 

Entry 3

GEISHA IdSMAD6.Alev.2010Data SourcePublication
Complete cDNA Template Probeshow
CTGAAGGCCCTGTGCGAATGTCAGAGCTTCGGGGCGGCCGACGGCCCCACCGTGTGCTGCAATCCGTACCACTTCAGCC
GGCTCTGTGGGCCAGAGTCTCCGCCGCCTCCCTACTCCCGGCTGTCTCCTAACGACGAGCAAAAGCCACTGGATCTCTC
GGATTCCACGTTGTCTTACACTGAAACAGAGGCGACGAACTCACCCAACGTCACGCCCGGGGAGTTCTCAGACGCCAGC
ACGTCGCCCGATGCCGTGAAGAGGAGCCATTGGTGCAACGTGGCCTACTGGGAGCACCGGACGCGCGTCGGCCGCCTCT
ACACAGTGTACGAACAGTCTGTCAGTATATTTTATGACCTACCTCAAGGAAACGGCTTCTGCCTCGGACAGCTAAACCT
GGAAAACAGGAGCGAGACTGTGAGAAGGACTCGAAGTAAAATCGGTTACGGGATTTTACTTAGCAAAGAACCGGACGGT
GTGTGGGCTTACAATCGCAGCGAGCATCCCATCTTCGTCAACTCCCCAACACTGGACATCCCCAACTGTAGGACTTTGA
TAGTGCGCAAGGTGATGCCGGGC
CitationAlev C, Wu Y, Kasukawa T, Jakt LM, Ueda HR, Sheng G. Transcriptomic landscape of the primitive streak. Development. 2010 Sep 1;137(17):2863-74. Epub 2010 Jul 28.
CopyrightPublished by The Company of Biologists 2010. This material is protected by a copyright retained by the authors. Permission granted by Dr. G Sheng.
CommentsThe probe for SMAD6 was amplified by PCR using the following primers: Forward Primer: GAAACAGAGGCGACGAACTC Reverse Primer: GAGCAAGATCTCCAGCCAAC Base Pair Numbers: 832-1407
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Epiblast
 

Entry 4

GEISHA IdSMAD6.Xie.2011Data SourcePublication
Complete cDNA Template Probeshow
GCCGCCGGGGACGCCCCCCTCCCCCTTTCTTTTTCCTCCCCCGTTTTATGCCCGGGCGCTGCCCCCCCGCCTCGGCCCC
CCCGTCCCCATGGCTCCCTGAGCCCCCCCTATGCCCCCCGCCTATGCCCTCCCCGCTGGGCGCTCCCCATCCCCTCCGC
CGCCGCCTTCCCCCATGGTGCGGCCCCGCCGCGGGCCGGGCGCTGCGGGCGGCTCCGGGGGCGGCGGCTCCGGGGGCGG
AGGCGGCGGACGGGCGATGAGGAGATAGAGGCGCGGAGCGGAGCGAGCCCCGGGCCGCCCTCGTATCGTATGTTCAGGT
CCAAACGCTCAGGGCTGGTGCGGCGGCTTTGGAGGAGCCGCGTTATCCCGGAGAGGGACGGAGGAGATGGGAACGGCCA
AAGCTCGGAGCGAAACGCGACGGCGGTGACGGCCGAGGGACAGCGCATGGCACAGCCGCGCCGGGCGCAGGAGGGCGAG
GGCCGCCCGGTGCGCTGCTGCCTGTTCGCCGAGCGGCCCGGCCCCGAGCTGCCGCCGCCGCCGCCTCCTCCTCCTCCCG
GCGGCGCCTCTCCCCCCGGGCCGGGCGGAGGCGAAGCGCGGTCGCGGTTGGTGCTGCTGGAGCGGGAGCTGAAGGCCGT
CACCTACGCGCTGCTGAAGCGGCTGAAGGAGCGCTCCCTGCACAGCCTCCTGCAGGCGGTGGAGTCGCGCGGCGGCACT
CCGGGCGGCTGCGTGTTGGTGGCCCGCGGGGAGCTGCGCCTGGGGGCGGCCAGGCGGCCCCCCCCACACCTGCTGCTGG
GGAAGCTGTTCCGCTGGCCCGACCTGCAGCACCCCGCCGAGCTGAAGGCCCTGTGCGAATGTCAGAGCTTCGGGGCGGC
CGACGGCCCCACCGTGTGCTGCAATCCGTACCACTTCAGCCGGCTCTGTGGGCCAGAGTCTCCGCCGCCTCCCTACTCC
CGGCTGTCTCCTAACGACGAGCAAAAGCCACTGGATCTCTCGGATTCCACGTTGTCTTACACTGAAACAGAGGCGACGA
ACTCACCCAACGTCACGCCCGGGGAGTTCTCAGACGCCAGCACGTCGCCCGATGCCGTGAAGAGGAGCCATTGGTGCAA
CGTGGCCTACTGGGAGCACCGGACGCGCGTCGGCCGCCTCTACACAGTGTACGAACAGTCTGTCAGTATATTTTATGAC
CTACCTCAAGGAAACGGCTTCTGCCTCGGACAGCTAAACCTGGAAAACAGGAGCGAGACTGTGAGAAGGACTCGAAGTA
AAATCGGTTACGGGATTTTACTTAGCAAAGAACCGGACGGTGTGTGGGCTTACAATCGCAGCGAGCATCCCATCTTCGT
CAACTCCCCAACACTGGACATCCCCAACTGTAGGACTTTGATAGTGCGCAAGGTGATGCCGGGCTATTCCATCAAGGTG
TTTGACTACGAGAAGTCCTGCCTCTTGCAGCACACTGCAGAGCTGGATTATGCAGACGGGCCCTACGACCCCAACAGCG
TGCGGATCAGCTTTGCCAAGGGCTGGGGGCCGTGTTACTCGAGACAGTTCATCACGTCTTGCCCGTGTTGGCTGGAGAT
CTTGCTCAGTAACAATCGATAACAGTCAGCCTCTGACGAAAGGAAAACAAAACAGAAAGACACAGACTATCCCAAATAT
CATCTACCTAGATTTAATATAAAGTTTTATATATTATATGAAAATATATATTATACTTGTAATTATGGAGTCATTTTTA
CAATGTAATTATTTATGTATGGTGCAATGTGTATATGGACAAAAAACAGAAAATGCACTTTGGCTTATATAATTCTTTC
AATACAGATTTAAAGAAAAAAAAAATTATACAGCAAAAATAGGAGAGAAAAGCCCTAATTTTGATGTATGGTTTTTTTT
GAAATATTATTAATACCCAGACAAAAAGCTAATACCAGTCACTCATTGATAATAAAGTATTCGCCTCGTGC
CitationXie Z, Chen Y, Li Z, Bai G, Zhu Y, Yan R, Tan F, Chen YG, Guillemot F, Li L, Jing N., Smad6 promotes neuronal differentiation in the intermediate zone of the dorsal neural tube by inhibition of the Wnt/beta-catenin pathway. Proc Natl Acad Sci U S A. 2011 Jul 19;108(29):12119-24. Epub 2011 Jul 5.
CopyrightCopyright ©2012 by the National Academy of Sciences
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204248.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
stage 24
Spinal Cord
 

Entry 5

GEISHA IdSMAD6.Olivera-Martinez.2014Data SourcePublication
Complete cDNA Template Probeshow
GGCGCTGCGGGCGGCTCCGGGGGCGGCGGCTCCGGGGGCGGAGGCGGCGGACGGGCGATGAGGAGATAGAGGCGCGGAG
CGGAGCGAGCCCCGGGCCGCCCTCGTATCGTATGTTCAGGTCCAAACGCTCAGGGCTGGTGCGGCGGCTTTGGAGGAGC
CGCGTTATCCCGGAGAGGGACGGAGGAGATGGGAACGGCCAAAGCTCGGAGCGAAACGCGACGGCGGTGACGGCCGAGG
GACAGCGCATGGCACAGCCGCGCCGGGCGCATGAGGGCGAGGGCCGCCCGGTGCGCTGCTGCCTGTTCGCCGAGCGGCC
CGGCCCCGAGCTGCCGCCGCCGCCGCCTCCTCCTCCTCCCGGCGGCGCCTCTCCCCCCGGGCCGGGCGGAGGCGAAGCG
CGGTCGCGGTTGGTGCTGCTGGAGCGGGAGCTGAAGGCCGTCACCTACGCGCTGCTGAAGCGGCTGAAGGAGCGCTCCC
TGCACAGCCTCCTGCAGGCGGTGGAGTCGCGCGGCGGCACTCCGGGCGGCTGCGTGTTGGTGGCCCGCGGGGAGCTGCG
CCTGGGGGGCGGCCAGGCGGCCCCCCCACACCTGCTGCTGGGGAAGCTGTTCCGCTGGCCCGACCTGCAGCACCCCGCC
GAGCTGAAGGCCCTGTGCGAATGTCAGAGCTTCGGGGCGGCCGACGGCCCCACCGTGTGCTGCAATCCGTACCACTTCA
GCCGGCTCTGTGGGCCAGAGTCTCCGCCGCCTCCCTACTCCCGGCTGTCTCCTAACGACGAGCAAAAGCCACTGGATCT
CTCGGATCCCACGTTGTCTTACACTGAAACGGAGGCGACGAACTCACCCAACGTCACGCCCGGGGAGTTCTCAGACGCC
AGCACGTCGCCCGATGCCGTGAAGAGGAGCCATTGGTGCAACGTGGCCTACTGGGAGCACCGGACGCGCGTCGGCCGCC
TCTACACAGTGTACGAACAGTCTGTCAGTATATTTTATGACCTACCTCAAGGAAACGGCTTCTGCCTCGGACAGCTAAA
CCTGGAAAACAGGAGCGAGACTGTGAGAAGGACTCGAAGTAAAATCGGTTACGGGATTTTACTTAGCAAAGAACCGGAC
GGTGTGTGGGCTTACAATCGCAGCGAGCATCCCATCTTCGTCAACTCCCCGACACTGGACATCCCCAACTGTAGGACTT
TGATAGTGCGCAAGGTGATGCCGGGCTATTCCATCAAGGTGTTTGACTACGAGAAGTCCTGCCTCTTGCAGCACACTGC
GGAGCTGGATTATGCAGACGGGCCCTACGACCCCAACAGCGTGCGGATCAGCTTTGCCAAGGGCTGGGGGCCGTGTTAC
TCGAGACAGTTCATCACGTCTTGCCCGTGTTGGCTGGAGATCTTGCTCAGTAACAATCGATAACAGTCAGCCTCTGACG
AAAGGAAAACAAAACAGAAAGACACAGACTATCCCAAATATCATCTACCTAGATTTAATATAAAGTTTTATATATTATA
TGAAAATATATATTATACTTGTAATTATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGG
ACAAAAAACAGAAAATGCACTTTGGCTTATATAATTCTTTCAATACAGATTTAAAGAAAAAAAAATTATACAGCAAAAA
TAGGAGAGAAAAGCCCTAATTTTGATGTATGGTTTTTTTTGAAATATTATTAATACCCAGACAAAAAGCTAATACCAGT
CACTCATTGATAATAAAGTATTCGCAT
CitationIsabel Olivera-Martinez, Nick Schurch, Roman A Li, Junfang Song, Pamela A Halley, Raman M Das, Dave W Burt, Geoffrey J Barton, Kate G Storey. Major transcriptome re-organisation and abrupt changes in signalling, cell cycle and chromatin regulation at neural differentiation in vivo. Development 2014 Aug;141(16):3266-76. Epub 2014 Jul 25. DOI: 10.1242/dev.112623.
CopyrightCopyright © 2014. Published by The Company of Biologists Ltd.
CommentsAuthors indicated the probe was made from gene construct provided by C. Stern. As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_204248.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Neural Plate/Tube
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3878

Mouse

EmageMGI:1336883
EurexpressMGI:1336883
MGI GXDMGI:1336883

Frog

Xenbase876705

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-011015-1, ZDB-GENE-050419-198
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona