GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SNAI1
snail family transcriptional repressor 1

Gene
Official SymbolSNAI1
Official Full Namesnail family transcriptional repressor 1
CGNC ID6068
also known aszinc finger protein SNAI1|snail homolog 1|snail like protein, snail
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205142
PolypeptideNP_990473
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3851
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly34906FBgn0001983
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene396047
Ensembl Gene
KEGGgga:396047

Entry 1

GEISHA IdSNAI1.UAPCRData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATGCCAGCAAGAAGCCCAACTAC
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGCGACCCAAAGATGTCCAGATGGcDNA Template Length832
Complete cDNA Template Probeshow
GCCAGCAAGAAGCCCAACTACAGCGAGCTAGAGAGCCAGACCGTGCTGGCTGCCCCGCTGCTGTATGAGACGTGTGCAC
TGTCCGTCATCCCTCCACCCGAAGTGCTGGGCCCTGGGGCCTATTACCCGCCGCTGGTGTGGGATGCTGGTCTGCTCTC
CAGCCTCTTCCCAGCTGGCCTGGGCACCGAGGCAGAGGCAGCAGGCGGTGCGGCACCAGCCCTGGACCTGACAACACTC
TCTAGTGAGGAGGATGAGGGCAAGAGCTCGGGGCCGCCCAGCCCGGCCTCAGCCCCTGCTGCTGCTGAGCGGTTCCGCT
GTGCCCAGTGCGCCAAGGCCTACTCCACCTTTGCTGGGCTCTCCAAGCACAAGCAATTGCACTGCGATGCTCAGACCAG
GAAATCCTTCAGCTGCAAGTACTGCGAGAAGGAGTATGTGAGCCTGGGGGCTCTCAAGATGCACATCCGGAGCCACACG
CTGCCCTGTGTCTGCAAGATGTGCGGCAAGGCCTTCTCCCGGCCCTGGTTGCTGCAGGGCCACATCCGAACGCACACTG
GTGAAAAGCCCTTTTCCTGTACACATTGCAACCGGGCCTTTGCTGACCGTTCTAATCTGCGCGCCCACCTGCAGACCCA
TTCAGATGTAAAGAAGTACCAGTGCAAAACCTGCTCCCGGACTTTCTCCCGTATGTCGCTGCTGCACAAGCACGAAGAG
ACGGGCTGCTCAGGGGCACGCTGAGGACCAGCACTCCTTTCCCGTGCAGATACATGTATTGTACCTAGTGTTTGTAGGA
GTTAGTTCCCTCCGTGCTGCCGTTGCCATGCACCTCGGACCGTACGCAGCCACAAGATCTACACGCTCCTATCCTGTGC
TCCTGTGCAACCTCAAGGCCTAATCCTGCACCCATCTGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Area Opaca
Epiblast
Lateral Plate Mesoderm
Paraxial Mesoderm
Splanchnic Mesoderm
 
7-12
stage 7
stage 8
stage 8
stage 8
stage 8
stage 8
stage 9
stage 9
stage 11
stage 11
stage 12
stage 12
Anterior Intestinal Portal
Blood Vessels
Head Mesenchyme
Intermediate Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
Somites
HH 8-
13-18
stage 15
stage 16
Blood Vessels
Head Mesenchyme
Lateral Plate Mesoderm
Pharyngeal Arches and Clefts
Somites
 
19-24
stage 20
Leg
Pharyngeal Arches and Clefts
Somites
Wing
 
25-26
stage 25
stage 26
Ear/Otic Placode
Eye
Face Mesenchyme
Leg Mesenchyme
Nasal Placode/Nerve
Oral Pharynx
Outflow Tract
Pharyngeal Arches and Clefts
Somites
Spinal Cord
Tail
Wing Mesenchyme
 

Entry 2

GEISHA IdSnail.Graham.2007Data SourcePublication
Complete cDNA Template Probeshow
GTGGCGCTTGGCAGTACGATGCCGCGCTCGTTCCTGGTGAAGAAGCACTTCTCGGCCAGCAAGAAGCCCAACTACAGCG
AGCTAGAGAGCCAGACCGTGCTGGCTGCCCCGCTGCTGTATGAGACGTGTGCACTGTCCGTCATCCCTCCACCCGAAGT
GCTGGGCCCTGGGGCCTATTACCCGCCGCTGGTGTGGGATGCTGGTCTGCTCTCCAGCCTCTTCCCAGCTGGCCTGGGC
ACCGAGGCAGAGGCAGCAGGCGGTGCGGCACCAGCCCTGGACCTGACAACACTCTCTAGTGAGGAGGATGAGGGCAAGA
GCTCGGGGCCGCCCAGCCCGGCCTCAGCCCCTGCTGCTGCTGAGCGGTTCCGCTGTGCCCAGTGCGCCAAGGCCTACTC
CACCTTTGCTGGGCTCTCCAAGCACAAGCAATTGCACTGCGATGCTCAGACCAGGAAATCCTTCAGCTGCAAGTACTGC
GAGAAGGAGTATGTGAGCCTGGGGGCTCTCAAGATGCACATCCGGAGCCACACGCTGCCCTGTGTCTGCAAGATGTGCG
GCAAGGCCTTCTCCCGGCCCTGGTTGCTGCAGGGCCACATCCGAACGCACACTGGTGAAAAGCCCTTTTCCTGTACACA
TTGCAACCGGGCCTTTGCTGACCGTTCTAATCTGCGCGCCCACCTGCAGACCCATTCAGATGTAAAGAAGTACCAGTGC
AAAACCTGCTCCCGGACTTTCTCCCGTATGTCGCTGCTGCACAAGCACGAAGAGACGGGCTGCTCAGGGGCACGCTGAG
GACCAGCACTCCTTTCCCGTGCAGATACATGTATTGTACCTAGTGTTTGTAGGAGTTAGTTCCCTCCGTGCTGCCGTTG
CCATGCACCTCGGACCGTACGCAGCCACAAGATCTACACGCTCCTATCCTGTGCTCCTGTGCAACCTCAAGGCCTAATC
CTGCACCCATCTGGACATCTTTGGGTCGAGGGTGGGACTCCCATGAGAGGTCGCCACGAGGCCTGGAGCATATGCAGCA
CCTTGCAGGTGACACTGCATCTCGATCACAGTGTTGGCATTCGCATGTGACTGT
CitationGraham A, Blentic A, Duque S, Begbie J. Delamination of cells from neurogenic placodes does not involve an epithelial-to-mesenchymal transition. Development. 2007 Dec;134(23):4141-5. Epub 2007 Oct 24.
CopyrightPublished by The Company of Biologists 2007
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205142).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
stage 18
Head Mesenchyme
Somites
Cranial Mesoderm
Post-migratory Neural Crest

Entry 3

GEISHA IdSnail.Garcia-Castro.2000Data SourcePublication
Complete cDNA Template Probeshow
GTGGCGCTTGGCAGTACGATGCCGCGCTCGTTCCTGGTGAAGAAGCACTTCTCGGCCAGCAAGAAGCCCAACTACAGCG
AGCTAGAGAGCCAGACCGTGCTGGCTGCCCCGCTGCTGTATGAGACGTGTGCACTGTCCGTCATCCCTCCACCCGAAGT
GCTGGGCCCTGGGGCCTATTACCCGCCGCTGGTGTGGGATGCTGGTCTGCTCTCCAGCCTCTTCCCAGCTGGCCTGGGC
ACCGAGGCAGAGGCAGCAGGCGGTGCGGCACCAGCCCTGGACCTGACAACACTCTCTAGTGAGGAGGATGAGGGCAAGA
GCTCGGGGCCGCCCAGCCCGGCCTCAGCCCCTGCTGCTGCTGAGCGGTTCCGCTGTGCCCAGTGCGCCAAGGCCTACTC
CACCTTTGCTGGGCTCTCCAAGCACAAGCAATTGCACTGCGATGCTCAGACCAGGAAATCCTTCAGCTGCAAGTACTGC
GAGAAGGAGTATGTGAGCCTGGGGGCTCTCAAGATGCACATCCGGAGCCACACGCTGCCCTGTGTCTGCAAGATGTGCG
GCAAGGCCTTCTCCCGGCCCTGGTTGCTGCAGGGCCACATCCGAACGCACACTGGTGAAAAGCCCTTTTCCTGTACACA
TTGCAACCGGGCCTTTGCTGACCGTTCTAATCTGCGCGCCCACCTGCAGACCCATTCAGATGTAAAGAAGTACCAGTGC
AAAACCTGCTCCCGGACTTTCTCCCGTATGTCGCTGCTGCACAAGCACGAAGAGACGGGCTGCTCAGGGGCACGCTGAG
GACCAGCACTCCTTTCCCGTGCAGATACATGTATTGTACCTAGTGTTTGTAGGAGTTAGTTCCCTCCGTGCTGCCGTTG
CCATGCACCTCGGACCGTACGCAGCCACAAGATCTACACGCTCCTATCCTGTGCTCCTGTGCAACCTCAAGGCCTAATC
CTGCACCCATCTGGACATCTTTGGGTCGAGGGTGGGACTCCCATGAGAGGTCGCCACGAGGCCTGGAGCATATGCAGCA
CCTTGCAGGTGACACTGCATCTCGATCACAGTGTTGGCATTCGCATGTGACTGT
CitationGarcía-Castro MI, Vielmetter E, Bronner-Fraser M. N-Cadherin, a cell adhesion molecule involved in establishment of embryonic left-right asymmetry. Science. 2000 May 12;288(5468):1047-51.
CopyrightCopyright © 2000, The American Association for the Advancement of Science
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205142).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-9
stage 9
stage 9
Lateral Plate Mesoderm
Somites
asymmetrical in the LPM

Entry 4

GEISHA IdSNAIL1.Delfini.2009Data SourcePublication
Complete cDNA Template Probeshow
GTGGCGCTTGGCAGTACGATGCCGCGCTCGTTCCTGGTGAAGAAGCACTTCTCGGCCAGCAAGAAGCCCAACTACAGCG
AGCTAGAGAGCCAGACCGTGCTGGCTGCCCCGCTGCTGTATGAGACGTGTGCACTGTCCGTCATCCCTCCACCCGAAGT
GCTGGGCCCTGGGGCCTATTACCCGCCGCTGGTGTGGGATGCTGGTCTGCTCTCCAGCCTCTTCCCAGCTGGCCTGGGC
ACCGAGGCAGAGGCAGCAGGCGGTGCGGCACCAGCCCTGGACCTGACAACACTCTCTAGTGAGGAGGATGAGGGCAAGA
GCTCGGGGCCGCCCAGCCCGGCCTCAGCCCCTGCTGCTGCTGAGCGGTTCCGCTGTGCCCAGTGCGCCAAGGCCTACTC
CACCTTTGCTGGGCTCTCCAAGCACAAGCAATTGCACTGCGATGCTCAGACCAGGAAATCCTTCAGCTGCAAGTACTGC
GAGAAGGAGTATGTGAGCCTGGGGGCTCTCAAGATGCACATCCGGAGCCACACGCTGCCCTGTGTCTGCAAGATGTGCG
GCAAGGCCTTCTCCCGGCCCTGGTTGCTGCAGGGCCACATCCGAACGCACACTGGTGAAAAGCCCTTTTCCTGTACACA
TTGCAACCGGGCCTTTGCTGACCGTTCTAATCTGCGCGCCCACCTGCAGACCCATTCAGATGTAAAGAAGTACCAGTGC
AAAACCTGCTCCCGGACTTTCTCCCGTATGTCGCTGCTGCACAAGCACGAAGAGACGGGCTGCTCAGGGGCACGCTGAG
GACCAGCACTCCTTTCCCGTGCAGATACATGTATTGTACCTAGTGTTTGTAGGAGTTAGTTCCCTCCGTGCTGCCGTTG
CCATGCACCTCGGACCGTACGCAGCCACAAGATCTACACGCTCCTATCCTGTGCTCCTGTGCAACCTCAAGGCCTAATC
CTGCACCCATCTGGACATCTTTGGGTCGAGGGTGGGACTCCCATGAGAGGTCGCCACGAGGCCTGGAGCATATGCAGCA
CCTTGCAGGTGACACTGCATCTCGATCACAGTGTTGGCATTCGCATGTGACTGT
CitationDelfini MC, De La Celle M, Gros J, Serralbo O, Marics I, Seux M, Scaal M, Marcelle C. The timing of emergence of muscle progenitors is controlled by an FGF/ERK/SNAIL1 pathway. Dev Biol. 2009 Sep 15;333(2):229-37. Epub 2009 May 13.
CopyrightCopyright © 2009 Published by Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205142.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
stage 20
stage 20
Dermomyotome
Myotome
Trunk Mesenchyme
 

Entry 5

GEISHA IdSNAII.Darnell.2010Data SourcePublication
Complete cDNA Template Probeshow
GTGGCGCTTGGCAGTACGATGCCGCGCTCGTTCCTGGTGAAGAAGCACTTCTCGGCCAGCAAGAAGCCCAACTACAGCG
AGCTAGAGAGCCAGACCGTGCTGGCTGCCCCGCTGCTGTATGAGACGTGTGCACTGTCCGTCATCCCTCCACCCGAAGT
GCTGGGCCCTGGGGCCTATTACCCGCCGCTGGTGTGGGATGCTGGTCTGCTCTCCAGCCTCTTCCCAGCTGGCCTGGGC
ACCGAGGCAGAGGCAGCAGGCGGTGCGGCACCAGCCCTGGACCTGACAACACTCTCTAGTGAGGAGGATGAGGGCAAGA
GCTCGGGGCCGCCCAGCCCGGCCTCAGCCCCTGCTGCTGCTGAGCGGTTCCGCTGTGCCCAGTGCGCCAAGGCCTACTC
CACCTTTGCTGGGCTCTCCAAGCACAAGCAATTGCACTGCGATGCTCAGACCAGGAAATCCTTCAGCTGCAAGTACTGC
GAGAAGGAGTATGTGAGCCTGGGGGCTCTCAAGATGCACATCCGGAGCCACACGCTGCCCTGTGTCTGCAAGATGTGCG
GCAAGGCCTTCTCCCGGCCCTGGTTGCTGCAGGGCCACATCCGAACGCACACTGGTGAAAAGCCCTTTTCCTGTACACA
TTGCAACCGGGCCTTTGCTGACCGTTCTAATCTGCGCGCCCACCTGCAGACCCATTCAGATGTAAAGAAGTACCAGTGC
AAAACCTGCTCCCGGACTTTCTCCCGTATGTCGCTGCTGCACAAGCACGAAGAGACGGGCTGCTCAGGGGCACGCTGAG
GACCAGCACTCCTTTCCCGTGCAGATACATGTATTGTACCTAGTGTTTGTAGGAGTTAGTTCCCTCCGTGCTGCCGTTG
CCATGCACCTCGGACCGTACGCAGCCACAAGATCTACACGCTCCTATCCTGTGCTCCTGTGCAACCTCAAGGCCTAATC
CTGCACCCATCTGGACATCTTTGGGTCGAGGGTGGGACTCCCATGAGAGGTCGCCACGAGGCCTGGAGCATATGCAGCA
CCTTGCAGGTGACACTGCATCTCGATCACAGTGTTGGCATTCGCATGTGACTGT
CitationDarnell DK, Stanislaw S, Kaur S, Antin PB. Whole mount in situ hybridization detection of mRNAs using short LNA containing DNA oligonucleotide probes. RNA. 2010 March; 16(3): 632–637.
CopyrightCopyright © 2010 RNA Society
CommentsProbes were multiple LNAs whose sequences can be found at http://rnajournal.cshlp.org/content/suppl/2010/01/08/rna.1775610.DC1/Supp_figs_S1_S3.pdf. NCBI (acc #NM_205142.1) is given for reference only.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
stage 12
Neural Crest
 
13-18
stage 15
Blood Vessels
 
19-24
stage 23
Wing Mesenchyme
 
25-30
stage 30
stage 30
Wing Mesenchyme
 

Entry 6

GEISHA IdSNAIL-1.Dady.2012Data SourcePublication
Complete cDNA Template Probeshow
GTGGCGCTTGGCAGTACGATGCCGCGCTCGTTCCTGGTGAAGAAGCACTTCTCGGCCAGCAAGAAGCCCAACTACAGCG
AGCTAGAGAGCCAGACCGTGCTGGCTGCCCCGCTGCTGTATGAGACGTGTGCACTGTCCGTCATCCCTCCACCCGAAGT
GCTGGGCCCTGGGGCCTATTACCCGCCGCTGGTGTGGGATGCTGGTCTGCTCTCCAGCCTCTTCCCAGCTGGCCTGGGC
ACCGAGGCAGAGGCAGCAGGCGGTGCGGCACCAGCCCTGGACCTGACAACACTCTCTAGTGAGGAGGATGAGGGCAAGA
GCTCGGGGCCGCCCAGCCCGGCCTCAGCCCCTGCTGCTGCTGAGCGGTTCCGCTGTGCCCAGTGCGCCAAGGCCTACTC
CACCTTTGCTGGGCTCTCCAAGCACAAGCAATTGCACTGCGATGCTCAGACCAGGAAATCCTTCAGCTGCAAGTACTGC
GAGAAGGAGTATGTGAGCCTGGGGGCTCTCAAGATGCACATCCGGAGCCACACGCTGCCCTGTGTCTGCAAGATGTGCG
GCAAGGCCTTCTCCCGGCCCTGGTTGCTGCAGGGCCACATCCGAACGCACACTGGTGAAAAGCCCTTTTCCTGTACACA
TTGCAACCGGGCCTTTGCTGACCGTTCTAATCTGCGCGCCCACCTGCAGACCCATTCAGATGTAAAGAAGTACCAGTGC
AAAACCTGCTCCCGGACTTTCTCCCGTATGTCGCTGCTGCACAAGCACGAAGAGACGGGCTGCTCAGGGGCACGCTGAG
GACCAGCACTCCTTTCCCGTGCAGATACATGTATTGTACCTAGTGTTTGTAGGAGTTAGTTCCCTCCGTGCTGCCGTTG
CCATGCACCTCGGACCGTACGCAGCCACAAGATCTACACGCTCCTATCCTGTGCTCCTGTGCAACCTCAAGGCCTAATC
CTGCACCCATCTGGACATCTTTGGGTCGAGGGTGGGACTCCCATGAGAGGTCGCCACGAGGCCTGGAGCATATGCAGCA
CCTTGCAGGTGACACTGCATCTCGATCACAGTGTTGGCATTCGCATGTGACTGT
CitationDady A, Blavet C, Duband JL Timing and kinetics of E- to N-cadherin switch during neurulation in the avian embryo DEVELOPMENTAL DYNAMICS. Volume 241, Issue 8, August 2012, Pages: 1333–1349.
CopyrightCopyright © 2012 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_205142.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
Primitive Streak
 
7-10
stage 7
stage 7
stage 10
Central Nervous System
Lateral Plate Mesoderm
Somites
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3851

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGPFBgn0001983

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona