GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SLIT2
slit guidance ligand 2

Gene
Official SymbolSLIT2
Official Full Nameslit guidance ligand 2
CGNC ID48982
also known asSlit, slit homolog 2 protein|slit-2, Slit2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001267075
PolypeptideNP_001254004
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.39631
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly36746FBgn0264089
Human9353ENSG00000145147MIM:603746
Mouse20563All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:1315205
Xenopus100492007, 3944041004409
Zebrafish80353ENSDARG00000004246ZDB-GENE-010306-3ZFIN:ZDB-GENE-010306-3
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene373967
Ensembl Gene
KEGGgga:373967

Entry 1

GEISHA IdSlit2.Holmes.2001Data SourcePublication
Forward cDNA Template Probeshow
GCCGCACCAGGACGAATCCGGGGGGGAGTCACGGCTGGGAGAGGAGCACGCGAAGGAGCCGGCGCTGCTGAAGCCGAGA
GCAGAGTGCCGCCCGTCCCCGCCATCCGACGGGTTACGGAGGGAGGGCCCGGCCAGGCCCCCTCCCCGCCAAGTTGCCT
TCAGCTGCGGATCGTTACCACCCGCCGTACTTTGCCGGGCTTGTTTGCTCGGCTCGGCTCTGGATACAGAGGACTTCGC
TTTCTCCGCACCCTGAAAGTTGCCCGAGCGCTCCCCGCGGCGAGGTGGAAGAGGAGGGCGGCGCGCCCCGCGCCTCCCC
GGGCCCGAGGCCGGCGGGCCCCGGCCGGGCGCAGCGGGCGGCGATGATGTGCGCCTGGGGGAGGCTCCCCCTGGCCCTG
GGGCTGCTGCTGGTGCTGGCGGGCGAGGCGGCGCCGCAGCCGTGCCCGGCGCAGTGCTCCTGCTCAGGAAGCACGGTGG
ACTGTCACGGGCTGGCGCTGCGCGGCGTCCCGAGGAACATCCCCCGCAACACCGAGCGGCTGGACCTTAATGGAAATAA
CATCACCAGAATCACCAAGACCGACTTTGCTGGTCTAAGGCACCTTCGAGTTCTTCAGCTCATGGAGAACAAGATTAGC
ACTATTGAGAGAGGAGCATTC
Reverse cDNA Template Probeshow
CAATGAATTTTCAGTCCTGGAAGCTACTGGGATCTTTAAGAAGCTTCNTCAACTGCGAAAAATAAACCTGAGCAATAAC
AAGATTACAGATATTGAAGAAGGTGCATTTGATGGAGCCTCTGGTGTCAATGAACTATTGCTCACTAGCAATCGTTTGG
AAACTGTTAGAGACAAAATGTTCAAAGGACTGGAAAGTCTTAAAACACTGATGCTGAGGAGCAACCGTGTGAGCTGTGT
GGGGAACGACAGTTTCACAGGCCTGAGCTCTGTCCGCCTGCTCTCACTGTATGACAACCAGATCACCACCGTGGCACCC
GGCTCCTTCGATACCCTGCATTCACTCTCTACATTAAACCTCTTGGCCAATCCTTTCAACTGCAACTGCCATCTTGCAT
GGCTTGGAGATTGGCTAAGGAAGAAACGCATTGTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAAAGAGAT
TCCTATCCAGGATGTGGCAATTCAGGATTTTACATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTGTCCCGC
TGTCCTGCAGAATGTACTTGTCTAGACACAGTTGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAGGCATCC
CAAAAGATGTAACTGAACTATATTTGGATGGAAACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAAACATTT
AACACTTATAGATTTAAGTAACAACAGAATCAGCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTGCTCACC
TTAATTCTTAGTTACAACCGCCTGAGGTGTATCCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGCTGTCTT
TACATGGCAATGATATTTCTGTGGTTCCTGAAGGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTATTGGAGC
AAATCCTCTTTATTGTGATTGTAACATGCAATGGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGTATTGCA
CGATGTGCTGGCCCTGGAGAAATGGCAGATAAACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAGGGCCCG
TGGATGTCAATATTCTTGCTAAGTGTAACCCCTGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAATGATCC
AGTTGACTTCTATAGATGTACTTGCCCATATGGTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGCATTAGT
AACCCTTGCAACCATGGTGGAACTTGTCATTTGAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAGATGGAT
TTGAAGGAGAAAATTGTGAAATAAATGTTGATGACTGTGAAGACAATGACTGTGAAAATAACTCGACTTGTGTAGATGG
AATTAATAATTATACTTGCCTTTGTCCACCTGAATATACAGGTGAGCTCTGTGAGGAGAAACTAGATTTCTGTGCTCAA
AACCTGAATCCTTGCCAGCACGACTCAAAGTGTATCTTGACTCCCAAAGGTTACAAGTGTGATTGCACACCTGGATATG
TAGGTGAACACTGCGATATTGACTTCGATGACTGCCAGGACAATAAATGTAAAAACGGAGCACAGTGTACGGATGCAGT
TAACGGGTATACTTGTATTTGCCCAGAGGGATACAGTGGCTTGTTTTGTGAGTTTTCGCCACCAATGGTTTTACCTCGC
ACCAGCCCTTGTGATAATTATGAATGCCAAAATGGAGCCCAGTGTATTGTAAAGGAGAGTGAACCAATCTGCCAGTGTT
TATCAGGCTACCAGGGTGAGAAATGTGAAAAGCTGATCAGTATAAACTTTGTCAACAAAGAATCCTATCTACAAATCCC
TTCAGCTAAGATACACTCCCAAACCAATATCACTCTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTCTACAAA
GGCGATAAGGATCATATAGCAGTAGAGCTGTACCGTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATCCAGCCT
CTGCTATTTACAGTGTGGAAACTATTAATGATGGCAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGATTCTGTC
TTTGTCTATTGATGGAGGAAGCCCCAAGATAATTACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCTCCACTG
TATGTCGGAGGCATGCCTGTGAAAAATAACATTGCAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCTTCCATG
GCTGCATCCGTAATCTGTATATCAACAGCGAACTCCAGGACTTCCAGAAATGGCCACTGC
CitationHolmes G, Niswander L. Expression of slit-2 and slit-3 during chick development. Dev Dyn. 2001 Oct;222(2):301-7.
CopyrightCopyright © 2001 Wiley-Liss, Inc. 2001
CommentsMiddle portion of probe could not be sequenced.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 19
stage 20
stage 22
stage 22
stage 22
stage 22
Cranial Ganglia
Dermatome
Ear/Otic Placcode
Forebrain
Hindbrain
Leg Muscles
Lens
Midbrain
Myotome
Neural Plate/Tube
Notochord
Pharyngeal Arches and Clefts
Retina
Wing Mesenchyme
Progress zone
base of the limb
branchial arches (I, II) and clefts,
diencephalon
dorsal floor plate
epibranchial placodes (ep) of ganglia VII/VIII and IX,
floor plate
forming dorsal muscle mass
forming ventral muscle mass
metencephalon
motor neurons
roof plate
ventral cephalic fold
25-30
stage 25
stage 28
stage 30
stage 30
Retina
Wing Mesenchyme
distal end of the fibula
inner periosteal cells of the metatarsals (mt2-4),
interdigital zones
limb margins
limb muscle
periosteal cells of the radius
periosteal cells of the ulna
peripheral to the phalangeal joints, and subepidermally.
proximal end of mt4
sensory layer of retina
subepidermally
tibiale
31-32
stage 32
stage 32
Wing Mesenchyme
interdigitally,
mesenchyme (me) radial to the outer flattened cells of the periosteum
periosteal cells along the metatarsals, peripheral to the joints, subepidermally, and interdigitally
periosteal cells,
subepidermally,

Entry 2

GEISHA IdSlit2.Wilson.2006Data SourcePublication
Complete cDNA Template Probeshow
GCCGCACCAGGACGAATCCGGGGGGGAGTCACGGCTGGGAGAGGAGCACGCGAAGGAGCCGGCGCTGCTGAAGCCGAGA
GCCGAGTGCCGCCCGTCCCCGCCATCCGACGGGTTACGGAGGGAGGGCCCGGCCAGGCCCCCTCCCCGCCAAGTTGCCT
TCAGCTGCGGATCGTTACCACCCGCCGTACTTTGCCGGGCTTGTTTGCTCGGCTCGGCTCTGGATAGAGAGGACTTCGC
TTTCTCCGCACCCTGAAAGTTGCCCGAGCGCTCCCCGCGGCGAGGTGGAAGAGGAGGGCGGCGCGCCCCGCGCCTCCCC
GGGCCCGAGGCCGGCGGGCCCCGGCCGGGCGCAGCGGGCGGCGATGATGTGCGCCTGGGGGAGGCTCCCCCTGGCCCTG
GGGCTGCTGCTGGTGCTGGCGGGCGAGGCGGCGCCGCAGCCGTGCCCGGCGCAGTGCTCCTGCTCAGGAAGCACGGTGG
ACTGTCACGGGCTGGCGCTGCGCGGCGTCCCGAGGAACATCCCCCGCAACACCGAGCGGCTGGACCTTAATGGAAATAA
CATCACCAGAATCACCAAGACCGACTTTGCTGGTCTAAGGCACCTTCGAGTTCTTCAGCTCATGGAGAACAAGATTAGC
ACTATTGAGAGAGGAGCATTCCAGGATTTAAAAGAACTGGAGAGGCTGCGCCTAAACAGAAATAACCTCCAGTTGCTTT
CTGAACTGCTCTTTCTGGGGACGCCGAAGTTATACAGGCTTGATCTTAGTGAAAATCAGATTCAAGCCATACCCAGGAA
GGCATTTCGTGGAGCAGTAGACATAAAAAATCTGCAACTGGATTACAACCAGATCAGCTGTATTGAAGATGGGGCATTT
AGGGCTCTGCGCGACCTGGAAGTGCTCACTCTCAACAACAATAACATTACTCGACTGTCCGTCGCAAGTTTCAATCATA
TGCCCAAACTCAGAACTTTTCGCCTGCACTCCAACAACCTCTACTGTGACTGCCACCTGGCCTGGCTGTCGGACTGGCT
GCGGCAGCGGCCACGTGTAGGCCTCTACACTCAGTGCATGGGCCCAGCACACCTGCGGGGCCATAACGTGGCTGAGGTC
CAGAAGCGGGAGTTCGTCTGCAGTGGTCACCAATCATTTATGGCTCCATCCTGCAGTGTCTTGCATTGTCCTGCTGCAT
GCACCTGTAGTAACAACATTGTGGACTGTCGTGGGAAAGGCCTTACTGAAATTCCAACAAATCTTCCAGAAACCATTAC
TGAAATACGGTTAGAACAAAATTCAATCAAAGTCATACCTCCTGGAGCTTTCTCACCCTATAAAAAGCTTCGAAGAATT
GACCTGAGCAATAACCAGATCTCTGAAGCAGCTCCAGATGCTTTCCAGGGCTTACGTTCTCTCAATTCACTTGTCCTCT
ATGGCAATAAAATTACAGAACTTCCAAAAGGCCTATTTGAAGGACTGTTTTCTCTGCAATTGCTATTATTAAATGCCAA
CAAGATCAATTGCCTGCGTGTTGATGCTTTTCAAGATCTGCACAACTTGAATCTCCTATCTTTATATGACAACAAGCTT
CAGACCATTGCAAAAGGCACCTTTTCACCTCTACGTGCAATTCAGACCTTGCATTTGGCTCAGAACCCATTTATCTGTG
ACTGCCATCTGAAGTGGCTGGCGGATTATCTTCATACAAACCCCATTGAGACCAGTGGTGCCCGCTGCACCAGCCCCCG
CCGTCTGGCAAACAAAAGGATCGGCCAGATCAAAAGCAAGAAATTCCGCTGCTCAGCTAAAGAGCAGTATTTCATTCCA
GGCACTGAAGATTACAGATCCAAATTAAGTGGTGACTGCTTTGCAGATTTGGCTTGCCCTGAGAAATGTCGCTGTGAAG
GGACCACAGTGGACTGCTCCAATCAGAAACTCAACAAAATTCCTGATCACATCCCACAGTACACAGCAGAGTTGCGACT
CAATAACAATGAATTTTCAGTCCTGGAAGCTACTGGGATCTTTAAGAAGCTTCCTCAACTGCGAAAAATAAACCTGAGC
AATAACAAGATTACAGATATTGAAGAAGGTGCATTTGATGGAGCCTCTGGTGTCAATGAACTATTGCTCACTAGCAATC
GTTTGGAAACTGTTAGAGACAAAATGTTCAAAGGACTGGAAAGTCTTAAAACACTGATGCTGAGGAGTAACCGTGTGAG
CTGTGTGGGGAACGACAGTTTCACAGGCCTGAGCTCTGTCCGTCTGCTCTCACTATATGACAACCAGATCACCACCGTG
GCACCCGGCTCCTTCGATACCCTGCATTCACTCTCTACATTAAACCTCTTGGCCAATCCTTTCAACTGCAACTGCCATC
TTGCATGGCTTGGAGATTGGCTAAGGAAGAAACGCATTGTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAA
AGAGATTCCTATCCAGGATGTGGCAATTCAGGATTTTACATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTG
TCCCGCTGTCCTGCAGAATGTACTTGTCTAGACACAGTTGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAG
GCATCCCAAAAGATGTAACTGAACTATATTTGGATGGAAACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAA
ACATTTAACACTTATAGATTTAAGTAACAACAGAATCAGCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTG
CTCACCTTAATTCTTAGTTACAACCGCCTGAGGTGTATCCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGC
TGTCTTTACATGGCAACGATATTTCTGTGGTTCCTGAAGGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTAT
TGGAGCAAATCCTCTTTATTGTGATTGTAACATGCAATGGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGT
ATTGCACGATGTGCTGGCCCTGGAGAAATGGCAGATAAACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAG
GGCCCGTGGATGTCAATATTCTTGCTAAGTGTAACCCCTGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAA
TGATCCAGTTGACTTCTATAGATGTACTTGCCCATATGGTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGC
ATTAGTAACCCTTGCAACCATGGTGGAACTTGTCATTTGAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAG
ATGGATTTGAAGGAGAAAATTGTGAAATAAATGTTGATGACTGTGAAGACAATGACTGTGAAAATAACTCTACTTGTGT
GGATGGAATTAATAATTATACTTGCCTTTGTCCACCTGAATATACAGGTGAGCTCTGTGAGGAGAAACTAGATTTCTGT
GCTCAAAACCTGAACCCTTGCCAGCACGACTCAAAGTGTATCTTGACTCCCAAAGGTTACAAGTGTGATTGCACACCTG
GATATGTAGGTGAACACTGCGATATTGACTTCGATGACTGCCAGGACAATAAATGTAAAAACGGAGCACAGTGTACGGA
TGCAGTTAACGGGTATACTTGTATTTGCCCAGAGGGATACAGTGGCTTGTTTTGTGAGTTTTCGCCACCAATGGTTTTA
CCTCGCACCAGCCCTTGTGATAATTATGAATGCCAAAATGGAGCCCAGTGTATTGTAAAGGAGAGTGAACCAATCTGCC
AGTGTTTATCAGGCTACCAGGGTGAGAAATGTGAAAAGCTGATCAGTATAAACTTTGTCAACAAAGAATCCTATCTACA
AATCCCTTCAGCTAAGATACACTCCCAAACCAATATCACTCTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTC
TACAAAGGCGATAAGGATCATATAGCAGTAGAGCTGTACCGTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATC
CAGCCTCTGCTATTTACAGTGTGGAAACTATTAATGATGGCAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGAT
TCTGTCTTTGTCTATTGATGGAGGAAGCCCCAAGATAATTACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCT
CCACTGTATGTCGGAGGCATGCCTGTGAAAAATAACATTGCAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCT
TCCATGGCTGCATCCGTAATCTGTATATCAACAGCGAACTCCAGGACTTCAGAAATGTGCCACTGCAAGTGGGAATTCT
GCCAGGTTGCGAGCCTTGTCACAAGAAAGTTTGTGTGCATGGAACATGCCATGCTACCAGCCAGTCAAGCTTTACCTGT
GAGTGTGAAGGAGGATGGACTGGACCCCTCTGTGATCAACAAACTAATGACCCGTGTCTCGGAAATAAATGTGTGCATG
GTACCTGCTTGCCGATCAATGCATTTTCATACAGTTGTAAATGCCTGCAGGGACATGGGGGAGTCCTCTGTGATGAAGA
GGAAATGCTGTTTAACCCCTGCCAATCCATCAGGTGTAAACATGGCAAATGCAGGCTTTCAGGACTTGGGAAACCATAT
TGCGAATGCAGCAGCGGATACACGGGGGACAGCTGTGATAAAGAAATCTCTTGTCGAGGGGAACGAATCCGAGATTACT
ACCAAAAGCAGCAAGGGTATGCTGCGTGCCAGACGACCAAGAAGGTATCGAGACTAGAATGTAAAGGAGGATGTTCAAC
CGGGCAGTGCTGTGGACCACTAAGGAGCAAGAGACGGAAATACTCTTTTGAATGCACTGATGGGTCGTCATTTGTGGAC
GAGATTGAAAAAGTGGTGAAGTGTGGCTGTACAAATTGTCCCTCCTAAGTGTTCCTGTCACACTTGTCTTTTGAAAATG
TTGTATACTTATTGACCGTGTCGGACTAATTAATGCTTCATAGTGGAAATATTTGAAATATATTGTAAAATACAGAACA
GACTTATTTTTATTATGAGAATAAAGACTTTTTCTTCATTTGAAAAAAGATTCAAGTGCTTGAACTGAGACTTCTCATA
ATCAAGAGGAGCTTTGAAGAAAAAAAAAGACCTGGTAACATTGCAACAGTGATGGGAAACTTAACTACTTTTAACACGG
ATTCTTCTTTATAACATGCTGAAGATACACTGACACTATACATACTCGACTTTCAACTTAACAGCTCAGAGATGAAATG
TTGATCAGAACATGTGTCTTGTTTTTTCATTTTCGTATCAGTATATTTTATTGTCTTAACAGACCATACCAATCACTTA
CCTATGGATGAGGATGCATACAGAGATAATTATTGTATGAAGTACATTTTATCTTTCAGAATTATTAAGCATCTTGAGA
AGATGAGGTCCCATTTAGTGGATGGGAAATGGGAGATATGAGAATATACTATAATCCTGAAATCTCCTGATGATGTACA
CTTTTATGTCAGCATGTTAACAAAAGAAGCATACAAAAAGTGTTTATCTGCCCTTTTCCAGTATTAATTTTTTGTAATA
TAAATGTTTGGGGGATGATGAAAATAGATTATTGATGGATAAATTAGTAATAATATGGATTTCTGTTTCTATGAGTTCT
AAAAACAACTCTATACAGTATTCGGTTTCATTGAGAAATATTTATTGTATCGAAGTACATTGTACTTAACCCTCCTAGG
TCATCCCTTTTACTGTTTTTCAATGCTTTAATATATATTAATTTATATTTGTCCCAGTATTTTTGTATTTTTTTTTTAA
AGAAAAAGACTTAAAAATCAGGATTTTTTGCAATAGAACTAACGTAGCATGTCGTCTTGGGGTAAATGTTTTTGGTCTG
TTCCTCCCCATCCCTTTCTCCTTTTCTTTTCCTTAGAATCTGACCACTTGGTGTCGCTGAATCTGAAAGTGATGACAAT
CTGCAGTTTTCACGTACAGCAGATATTCAGGACACCTTCCAGGAACCTATACTGCGTGACAGAAAATGTCTTTTACACT
AGGTGGCAATTGTAGAGAAATTAATTTTCCCTATATACAGTACTTACAGAAAATGAGATGGCATGTAGAAAATGGCATT
AGAAGGTAGATCTTTATAAATTAATATTCCCATGGAGCCCTTTACCTTTTTTTTATAAAGAAAAAAAGAAAAAAAGGCT
GTGCTATCAAGAACTGTGACTTTCCCCAAATAATAAAGCTACTTTACTGCCCTAATGTTCCCCACGTTAACATGTTGCT
GCTAAATTATAATGTAGAATTGGTAATCATTAATAGTGGGTTGTGTTCTTCTTTCAGTAAAACCCAGGGTACCCTGTAA
AAATGCAGATGTTTTTCAATTTTATTTTATTATTTTTTTTACAAAAAAAAGTTAGGTGTACATGTGTAATGCAGTGTGC
TTTGTCTTATTTGGACTGATATCAGTAATGCTACTGATGTTTGTAAATTAAACAGATATTTACTTCACT
CitationWilson LJ, Wingate RJ (2006). Temporal identity transition in the avian cerebellar rhombic lip. Dev Biol. 2006 Sep 15;297(2):508-21. Epub 2006 May 26.
CopyrightCopyright © 2006 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc #XM_001232040).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Neural Plate/Tube
Notochord
 

Entry 3

GEISHA IdSlit2.Riley.2010Data SourcePublication
Complete cDNA Template Probeshow
TGGAGCCTCTGGTGTCAATGAACTATTGCTCACTAGCAATCGTTTGGAAACTGTTAGAGACAAAATGTTCAAAGGACTG
GAAAGTCTTAAAACACTGATGCTGAGGAGCAACCGTGTGAGCTGTGTGGGGAACGACAGTTTCACAGGCCTGAGCTCTG
TCCGCCTGCTCTCACTGTATGACAACCAGATCACCACCGTGGCACCCGGCTCCTTCGATACCCTGCATTCACTCTCTAC
ATTAAACCTCTTGGCCAATCCTTTCAACTGCAACTGCCATCTTGCATGGCTTGGAGATTGGCTAAGGAAGAAACGCATT
GTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAAAGAGATTCCTATCCAGGATGTGGCAATTCAGGATTTTA
CATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTGTCCCGCTGTCCTGCAGAATGTACTTGTCTAGACACAGT
TGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAGGCATCCCAAAAGATGTAACTGAACTATATTTGGATGGA
AACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAAACATTTAACACTTATAGATTTAAGTAACAACAGAATCA
GCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTGCTCACCTTAATTCTTAGTTACAACCGCCTGAGGTGTAT
CCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGCTGTCTTTACATGGCAATGATATTTCTGTGGTTCCTGAA
GGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTATTGGAGCAAATCCTCTTTATTGTGATTGTAACATGCAAT
GGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGTATTGCACGATGTGCTGGCCCTGGAGAAATGGCAGATAA
ACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAGGGCCCGTGGATGTCAATATTCTTGCTAAGTGTAACCCC
TGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAATGATCCAGTTGACTTCTATAGATGTACTTGCCCATATG
GTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGCATTAGTAACCCTTGCAACCATGGTGGAACTTGTCATTT
GAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAGATGGATTTGAAGGAGAAAATTGTGAAATAAATGTTGAT
GACTGTGAAGACAATGACTGTGAAAATAACTCGACTTGTGTAGATGGAATTAATAATTATACTTGCCTTTGTCCACCTG
AATATACAGGTGAGCTCTGTGAGGAGAAACTAGATTTCTGTGCTCAAAACCTGAATCCTTGCCAGCACGACTCAAAGTG
TATCTTGACTCCCAAAGGTTACAAGTGTGATTGCACACCTGGATATGTAGGTGAACACTGCGATATTGACTTCGATGAC
TGCCAGGACAATAAATGTAAAAACGGAGCACAGTGTACGGATGCAGTTAACGGGTATACTTGTATTTGCCCAGAGGGAT
ACAGTGGCTTGTTTTGTGAGTTTTCGCCACCAATGGTTTTACCTCGCACCAGCCCTTGTGATAATTATGAATGCCAAAA
TGGAGCCCAGTGTATTGTAAAGGAGAGTGAACCAATCTGCCAGTGTTTATCAGGCTACCAGGGTGAGAAATGTGAAAAG
CTGATCAGTATAAACTTTGTCAACAAAGAATCCTATCTACAAATCCCTTCAGCTAAGATACACTCCCAAACCAATATCA
CTCTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTCTACAAAGGCGATAAGGATCATATAGCAGTAGAGCTGTA
CCGTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATCCAGCCTCTGCTATTTACAGTGTGGAAACTATTAATGAT
GGCAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGATTCTGTCTTTGTCTATTGATGGAGGAAGCCCCAAGATAA
TTACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCTCCACTGTATGTCGGAGGCATGCCTGTGAAAAATAACAT
TGCAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCTTCCATGGCTGCATCCGTAATCTGTATATCAACAGCGAA
CTCCAGGACTTCAGAAATGTGCCACTGCAAGTGGGAATTCTGCCAGGTTGCGAGCCTTGTCACAAGAAAGTTTGTGTGC
ATGGAACATGCCATGCTACCAGCCAGTCAAGCTTTACCTGTGAGTGTGAAGGAGGATGGACTGGACCCCTCTGTGATCA
ACAAACTAATGACCCGTGTCTCGGAAATAAATGTGTGCATGGTACCTGCTTGCCGATCAATGCATTTTCATACAGTTGT
AAATGCCTGCAGGGACATGGGGGAGTCCTCTGTGATGAAGAGGAAATGCTGTTTAACCCCTGCCAATCCATCAGGTGTA
AACATGGCAAATGCAGGCTTTCAGGACTTGGGAAACCATATTGCGAATGCAGCAGCGGATACACGGGGGACAGCTGTGA
TAAAGAAATCTCTTGTCGAGGGGAACGAATCCGAGATTACTACCAAAAGCAGCAAGGGTATGCTGCGTGCCAGACGACC
AAGAAGGTATCGAGACTAGAATGTAAAGGAGGATGTTCAACCGGGCAGTGCTGTGGACCACTAAGGAGCAAGAGACGGA
AATACTCTTTTGAATGCACTGATGGGTCGTCATTTGTGGACGAGATTGAAAAAGTGGTGAAGTGTGGCTGTACAAATTG
TCCCTCCTAAGTGTTCCTGTCACACTTGTCTTTTGAAAATGTTGTATACTTATTGACCGTGTCGGACTAATTAATGCTT
CATAGTGGAAATATTTGAAATATATTGTAAAATACAGAACAGACTTATTTTTATTATGAGAATAAAGACTTTTTCTTCA
TTTGAAAAAAGATTCAAGTGCTTGAACTGAGACTTCTCATAATCAAGAGGAGCTTTGAAGAAAAAAAAAGACCTGGTAA
CATTGCAACAGTGATGGGAAACTTAACTACTTTTAACACGGATTCTTCTTTATAACATGCTGAAGATACACTGACACTA
TACATACTCGACTTTCAACTTAACAGCTCAGAGATGAAATGTTGATCAGAACATGTGTCTTGTTTTTTCATTTTCGTAT
CAGTATATTTTATTGTCTTGACAGACCATACCAATCACTTACCTATGGATGAGGATGCATACAGAGATAATTATTGTAT
GAAGTACATTTTATCTTTCAGAATTATTAAGCATCTTGAGAAGATGAGGTCCCATTTAGTGGATGGGAAATGGGAGATA
TGAGAATATACTATAATCCTGAAATCTCCTGATGATGTACACTTTTATGTCAGCATGTTAACAAAAGAAGCATACAAAA
AGTGTTTATCTGCCCTTTTCCAGTATTAATTTTTTGTAATATAAATGTTTGGGGGATGATGAAAATAGATTATTGATGG
ATAAATTAGTAATAATATGGATTTCTGTTTCTATGAGTTCTAAAAACAACTCTATACAGTATTCGGTTTCATTGAGAAA
TATTTATTGTATCGAAGTACATTGTACTTAACCCTCCTAGGTCATCCCTTTTACTGTTTTTCAATGCTTTAATATATAT
TAATTTATATTTGTCCCAGTATTTTTGTATTTTTTTTTTAAAGAAAAAGACTTAAAAATCAGGATTTTTTGCAATAGAA
CTAACGTAGCATGTCGTCTTGGGGTAAATGTTTTTGGTCTGTTCCTCCCCATCCCTTTCTCCTTTTCTTTTCCTTAGAA
TCTGACCACTTGGTGTCGCTGAATCTGAAAGTGATGACAATCTGCAGTTTTCACGTACAGCAGATATTCAGGACACCTT
CCAGGAACCTATACTGTGTGACAGAAAATGTCTTTTACACTAGGTGGCAATTGTAGAGAAATTAATTTTCCCTATATAC
AGTACTTACAGAAAATGAGATGGCATGTAGAAAATGGCATTAGAAGGTAGATCTTTATAAATTAATATTCCCATGGAGC
CCTTTACCTTTTTTTTTATAAAGAAAAAAAGAAAAAAAGGCTGTGCTATCAAGAACTGTGACTTTCCCCAAATAATAAA
GCTACTTTACTGCCCTAATGTTCCCCACGTTAACATGTTGCTGCTAAATTATAATGTAGAATTGGTAATCATTAATAGT
GGGTTGTGTTCTTCTTTCAGTAAAACCCAGGGTACCCTGTAAAAATGCAGATGTTTTTCAATTTTATTTTATTATTTTT
TTTACAAAAAAAAGTTAGGTGTACATGTGTAATGCAGTGTGCTTTGTCTTATTTGGACTGATATCAGTAATGCTACTGA
TGTTTGTAAATTAAACAGATATTTACTTCAAAA
CitationRiley KL, Gledhill S, Schubert FR. Early expression of axon guidance molecules in the embryonic chick mesencephalon and pretectum. Int J Dev Biol. 2010;54(4):743-53.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 13
stage 13
stage 18
Midbrain
Neural Plate/Tube
 
19-21
stage 21
Midbrain
 

Entry 4

GEISHA IdSlit2.Conrad.2009Data SourcePublication
Complete cDNA Template Probeshow
CTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTCTACAAAGGCGATAAGGATCATATAGCAGTAGAGCTGTACC
GTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATCCAGCCTCTGCTATTTACAGTGTGGAAACTATTAATGATGG
CAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGATTCTGTCTTTGTCTATTGATGGAGGAAGCCCCAAGATAATT
ACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCTCCACTGTATGTCGGAGGCATGCCTGTGAAAAATAACATTG
CAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCTTCCATGGCTGCATCCGTAATCTGTATATCAACAGCGAACT
CCAGGACTTCAGAAATGTGCCACTGCAAGTGGGAATTCTGCCAGGTTGCGAGCCTTGTCACAAGAAAGTTTGTGTGCAT
GGAACATGCCATGCTACCAGCCAGTCAAGCTTTACCTGTGAGTGTGAAGGAGGATGGACTGGACCCCTCTGTGATCAAC
AAACTAATGACCCGTGTCTCGGAAATAAATGTGTGCATGGTACCTGCTTGCCGATCAATGCATTTTCATACAGTTGTAA
ATGCCTGCAGGGACAT
CitationConrad AH, Albrecht M, Pettit-Scott M, Conrad GW. Embryonic corneal Schwann cells express some Schwann cell marker mRNAs, but no mature Schwann cell marker proteins.Invest Ophthalmol Vis Sci. 2009 Sep;50(9):4173-84. Epub 2009 Apr 22.
CopyrightInformation that is created by or for the US government on this site is within the public domain. Public domain information on the National Library of Medicine (NLM) Web pages may be freely distributed and copied. However, it is requested that in any subsequent use of this work, NLM be given appropriate acknowledgment.
CommentsAuthors indicated the probe was generated using these PCR primers: 5′-CTTCAGATTGCCACAGACGA 5′-ATGTCCCTGCAGGCATTTAC Sequence for the probe was extracted from NCBI Acc.# XM_001232040.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-40
stage 40
stage 40
stage 40
Eye
 

Entry 5

GEISHA IdSLIT2.Kubilus.2010Data SourcePublication
Complete cDNA Template Probeshow
AGAAACGCATTGTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAAAGAGATTCCTATCCAGGATGTGGCAAT
TCAGGATTTTACATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTGTCCCGCTGTCCTGCAGAATGTACTTGT
CTAGACACAGTTGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAGGCATCCCAAAAGATGTAACTGAACTAT
ATTTGGATGGAAACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAAACATTTAACACTTATAGATTTAAGTAA
CAACAGAATCAGCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTGCTCACCTTAATTCTTAGTTACAACCGC
CTGAGGTGTATCCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGCTGTCTTTACATGGCAACGATATTTCTG
TGGTTCCTGAAGGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTATTGGAGCAAATCCTCTTTATTGTGATTG
TAACATGCAATGGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGTATTGCACGATGTGCTGGCCCTGGAGAA
ATGGCAGATAAACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAGGGCCCGTGGATGTCAATATTCTTGCTA
AGTGTAACCCCTGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAATGATCCAGTTGACTTCTATAGATGTAC
TTGCCCATATGGTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGCATTAGTAACCCTTGCAACCATGGTGGA
ACTTGTCATTTGAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAGA
CitationKubilus JK, Linsenmayer TF. Developmental guidance of embryonic corneal innervation: roles of Semaphorin3A and Slit2. Dev Biol. 2010 Aug 1;344(1):172-84. Epub 2010 May 18.
CopyrightCopyright © 2011 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # XM_001232040.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 26
Eye
Lens
cornea
31-40
stage 31
stage 40
stage 40
Eye
Lens
CE- corneal epithelium
CS- corneal stroma

Entry 6

GEISHA IdSLIT2.Battisti.2008Data SourcePublication
Complete cDNA Template Probeshow
GCCGCACCAGGACGAATCCGGGGGGGAGTCACGGCTGGGAGAGGAGCACGCGAAGGAGCCGGCGCTGCTGAAGCCGAGA
GCCGAGTGCCGCCCGTCCCCGCCATCCGACGGGTTACGGAGGGAGGGCCCGGCCAGGCCCCCTCCCCGCCAAGTTGCCT
TCAGCTGCGGATCGTTACCACCCGCCGTACTTTGCCGGGCTTGTTTGCTCGGCTCGGCTCTGGATAGAGAGGACTTCGC
TTTCTCCGCACCCTGAAAGTTGCCCGAGCGCTCCCCGCGGCGAGGTGGAAGAGGAGGGCGGCGCGCCCCGCGCCTCCCC
GGGCCCGAGGCCGGCGGGCCCCGGCCGGGCGCAGCGGGCGGCGATGATGTGCGCCTGGGGGAGGCTCCCCCTGGCCCTG
GGGCTGCTGCTGGTGCTGGCGGGCGAGGCGGCGCCGCAGCCGTGCCCGGCGCAGTGCTCCTGCTCAGGAAGCACGGTGG
ACTGTCACGGGCTGGCGCTGCGCGGCGTCCCGAGGAACATCCCCCGCAACACTGAGCGGCTGGACCTTAATGGAAATAA
CATCACCAGAATCACCAAGACCGACTTTGCTGGTCTAAGGCACCTTCGAGTTCTTCAGCTCATGGAGAACAAGATTAGC
ACTATTGAGAGAGGAGCATTCCAGGATTTAAAAGAACTGGAGAGGCTGCGCCTAAACAGAAATAACCTCCAGTTGCTTT
CTGAACTGCTCTTTCTGGGGACGCCGAAGTTATACAGGCTTGATCTTAGTGAAAATCAGATTCAAGCCATACCCAGGAA
GGCATTTCGTGGAGCAGTAGACATAAAAAATCTGCAACTGGATTACAACCAGATCAGCTGTATTGAAGATGGGGCATTT
AGGGCTCTACGCGACCTGGAAGTGCTCACTCTCAACAACAATAACATTACTCGACTGTCCGTCGCAAGTTTCAATCATA
TGCCCAAACTCAGAACTTTTCGCCTGCACTCCAACAACCTCTACTGTGACTGCCACCTGGCCTGGCTGTCGGACTGGCT
GCGGCAGCGGCCACGTGTAGGCCTCTACACTCAGTGCATGGGCCCAGCACACCTGCGGGGCCATAACGTGGCTGAGGTC
CAGAAGCGGGAGTTCGTCTGCAGTGGTCACCAATCATTTATGGCTCCATCCTGCAGTGTCTTGCATTGTCCTGCTGCAT
GCACCTGTAGTAACAACATTGTGGACTGTCGTGGGAAAGGCCTTACTGAAATTCCAACAAATCTTCCAGAAACCATTAC
TGAAATACGGTTAGAACAAAATTCAATCAAAGTCATACCTCCTGGAGCTTTCTCACCCTATAAAAAGCTTCGAAGAATT
GACCTGAGCAATAACCAGATCTCTGAAGCAGCTCCAGATGCTTTCCAGGGCTTACGTTCTCTCAATTCACTTGTCCTCT
ATGGCAATAAAATTACAGAACTTCCAAAAGGCCTATTTGAAGGACTGTTTTCTCTGCAATTGCTATTATTAAATGCCAA
CAAGATCAATTGCCTGCGTGTTGATGCTTTTCAAGATCTGCACAACTTGAATCTCCTATCTTTATATGACAACAAGCTT
CAGACCATTGCAAAAGGCACCTTTTCACCTCTACGTGCAATTCAGACCTTGCATTTGGCTCAGAACCCATTTATCTGTG
ACTGCCATCTGAAGTGGCTGGCGGATTATCTTCATACAAACCCCATTGAGACCAGTGGTGCCCGCTGCACCAGCCCCCG
CCGTCTGGCAAACAAAAGGATCGGCCAGATCAAAAGCAAGAAATTCCGCTGCTCAGCTAAAGAGCAGTATTTCATTCCA
GGCACTGAAGATTACAGATCCAAATTAAGTGGTGACTGCTTTGCAGATTTGGCTTGCCCTGAGAAATGTCGCTGTGAAG
GGACCACAGTGGACTGCTCCAATCAGAAACTCAACAAAATTCCTGATCACATCCCACAGTACACAGCAGAGTTGCGACT
CAATAACAATGAATTTTCAGTCCTGGAAGCTACTGGGATCTTTAAGAAGCTTCCTCAACTGCGAAAAATAAACCTGAGC
AATAACAAGATTACAGATATTGAAGAAGGTGCATTTGATGGAGCCTCTGGTGTCAATGAACTATTGCTCACTAGCAATC
GTTTGGAAACTGTTAGAGACAAAATGTTCAAAGGACTGGAAAGTCTTAAAACACTGATGCTGAGGAGTAACCGTGTGAG
CTGTGTGGGGAACGACAGTTTCACAGGCCTGAGCTCTGTCCGTCTGCTCTCACTATATGACAACCAGATCACCACCGTG
GCACCCGGCTCCTTCGATACCCTGCATTCACTCTCTACATTAAACCTCTTGGCCAATCCTTTCAACTGCAACTGCCATC
TTGCATGGCTTGGAGATTGGCTAAGGAAGAAACGCATTGTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAA
AGAGATTCCTATCCAGGATGTGGCAATTCAGGATTTTACATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTG
TCCCGCTGTCCTGCAGAATGTACTTGTCTAGACACAGTTGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAG
GCATCCCAAAAGATGTAACTGAACTATATTTGGATGGAAACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAA
ACATTTAACACTTATAGATTTAAGTAACAACAGAATCAGCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTG
CTCACCTTAATTCTTAGTTACAACCGCCTGAGGTGTATCCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGC
TGTCTTTACATGGCAATGATATTTCTGTGGTTCCTGAAGGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTAT
TGGAGCAAATCCTCTTTATTGTGATTGTAACATGCAATGGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGT
ATTGCACGATGTGCTGGCCCTGGAGAAATGGCAGATAAACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAG
GGCCCGTGGATGTCAATATTCTTGCTAAGTGTAACCCCTGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAA
TGATCCAGTTGACTTCTATAGATGTACTTGCCCATATGGTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGC
ATTAGTAACCCTTGCAACCATGGTGGAACTTGTCATTTGAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAG
ATGGATTTGAAGGAGAAAATTGTGAAATAAATGTTGATGACTGTGAAGACAATGACTGTGAAAATAACTCTACTTGTGT
GGATGGAATTAATAATTATACTTGCCTTTGTCCACCTGAATATACAGGTGAGCTCTGTGAGGAGAAACTAGATTTCTGT
GCTCAAAACCTGAACCCTTGCCAGCACGACTCAAAGTGTATCTTGACTCCCAAAGGTTACAAGTGTGATTGCACACCTG
GATATGTAGGTGAACACTGCGATATTGACTTCGATGACTGCCAGGACAATAAATGTAAAAACGGAGCACAGTGTACGGA
TGCAGTTAACGGGTATACTTGTATTTGCCCAGAGGGATACAGTGGCTTGTTTTGTGAGTTTTCGCCACCAATGGTTTTA
CCTCGCACCAGCCCTTGTGATAATTATGAATGCCAAAATGGAGCCCAGTGTATTGTAAAGGAGAGTGAACCAATCTGCC
AGTGTTTATCAGGCTACCAGGGTGAGAAATGTGAAAAGCTGATCAGTATAAACTTTGTCAACAAAGAATCCTATCTACA
AATCCCTTCAGCTAAGATACACTCCCAAACCAATATCACTCTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTC
TACAAAGGCGATAAGGATCATATAGCAGTAGAGCTGTACCGTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATC
CAGCCTCTGCTATTTACAGTGTGGAAACTATTAATGATGGCAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGAT
TCTGTCTTTGTCTATTGATGGAGGAAGCCCCAAGATAATTACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCT
CCACTGTATGTCGGAGGCATGCCTGTGAAAAATAACATTGCAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCT
TCCATGGCTGCATCCGTAATCTGTATATCAACAGCGAACTCCAGGACTTCAGAAATGTGCCACTGCAAGTGGGAATTCT
GCCAGGTTGCGAGCCTTGTCACAAGAAAGTTTGTGTGCATGGAACATGCCATGCTACCAGCCAGTCAAGCTTTACCTGT
GAGTGTGAAGGAGGATGGACTGGACCCCTCTGTGATCAACAAACTAATGACCCGTGTCTCGGAAATAAATGTGTGCATG
GTACCTGCTTGCCGATCAATGCATTTTCATACAGTTGTAAATGCCTGCAGGGACATGGGGGAGTCCTCTGTGATGAAGA
GGAAATGCTGTTTAACCCCTGCCAATCCATCAGGTGTAAACATGGCAAATGCAGGCTTTCAGGACTTGGGAAACCATAT
TGCGAATGCAGCAGCGGATACACGGGGGACAGCTGTGATAAAGAAATCTCTTGTCGAGGGGAACGAATCCGAGATTACT
ACCAAAAGCAGCAAGGGTATGCTGCGTGCCAGACGACCAAGAAGGTATCGAGACTAGAATGTAAAGGAGGATGTTCAAC
CGGGCAGTGCTGTGGACCACTAAGGAGCAAGAGACGGAAATACTCTTTTGAATGCACTGATGGGTCGTCATTTGTGGAC
GAGATTGAAAAAGTGGTGAAGTGTGGCTGTACAAATTGTCCCTCCTAAGTGTTCCTGTCACACTTGTCTTTTGAAAATG
TTGTATACTTATTGACCGTGTCGGACTAATTAATGCTTCATAGTGGAAATATTTGAAATATATTGTAAAATACAGAACA
GACTTATTTTTATTATGAGAATAAAGACTTTTTCTTCATTTGAAAAAAGATTCAAGTGCTTGAACTGAGACTTCTCATA
ATCAAGAGGAGCTTTGAAGAAAAAAAAAGACCTGGTAACATTGCAACAGTGATGGGAAACTTAACTACTTTTAACACGG
ATTCTTCTTTATAACATGCTGAAGATACACTGACACTATACATACTCGACTTTCAACTTAACAGCTCAGAGATGAAATG
TTGATCAGAACATGTGTCTTGTTTTTTCATTTTCGTATCAGTATATTTTATTGTCTTAACAGACCATACCAATCACTTA
CCTATGGATGAGGATGCATACAGAGATAATTATTGTATGAAGTACATTTTATCTTTCAGAATTATTAAGCATCTTGAGA
AGATGAGGTCCCATTTAGTGGATGGGAAATGGGAGATATGAGAATATACTATAATCCTGAAATCTCCTGATGATGTACA
CTTTTATGTCAGCATGTTAACAAAAGAAGCATACAAAAAGTGTTTATCTGCCCTTTTCCAGTATTAATTTTTTGTAATA
TAAATGTTTGGGGGATGATGAAAATAGATTATTGATGGATAAATTAGTAATAATATGGATTTCTGTTTCTATGAGTTCT
AAAAACAACTCTATACAGTATTCGGTTTCATTGAGAAATATTTATTGTATCGAAGTACATTGTACTTAACCCTCCTAGG
TCATCCCTTTTACTGTTTTTCAATGCTTTAATATATATTAATTTATATTTGTCCCAGTATTTTTGTATTTTTTTTTTAA
AGAAAAAGACTTAAAAATCAGGATTTTTTGCAATAGAACTAACGTAGCATGTCGTCTTGGGGTAAATGTTTTTGGTCTG
TTCCTCCCCATCCCTTTCTCCTTTTCTTTTCCTTAGAATCTGACCACTTGGTGTCGCTGAATCTGAAAGTGATGACAAT
CTGCAGTTTTCACGTACAGCAGATATTCAGGACACCTTCCAGGAACCTATACTGCGTGACAGAAAATGTCTTTTACACT
AGGTGGCAATTGTAGAGAAATTAATTTTCCCTATATACAGTACTTACAGAAAATGAGATGGCATGTAGAAAATGGCATT
AGAAGGTAGATCTTTATAAATTAATATTCCCATGGAGCCCTTTACCTTTTTTTTATAAAGAAAAAAAGAAAAAAAGGCT
GTGCTATCAAGAACTGTGACTTTCCCCAAATAATAAAGCTACTTTACTGCCCTAATGTTCCCCACGTTAACATGTTGCT
GCTAAATTATAATGTAGAATTGGTAATCATTAATAGTGGGTTGTGTTCTTCTTTCAGTAAAACCCAGGGTACCCTGTAA
AAATGCAGATGTTTTTCAATTTTATTTTATTATTTTTTTTACAAAAAAAAGTTAGGTGTACATGTGTAATGCAGTGTGC
TTTGTCTTATTTGGACTGATATCAGTAATGCTACTGATGTTTGTAAATTAAACAGATATTTACTTCACTAACTGCTTTT
ATTTGTATTCTTCTGAAAAGTTCAAATTGTCTAACAGCCTTTAATTAAACACTTGTAGTTGCAAACAGTATTTGGTATA
AAGAAAAAAAAAAAGAGAATTAA
CitationBattisti AC, Fekete DM. Slits and Robos in the developing chicken inner ear. Dev Dyn. 2008 Feb;237(2):476-84.
CopyrightCopyright © 2008 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # XM_001232040.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 14
stage 17
Ear/Otic Placode
 
19-24
stage 23
stage 23
stage 23
stage 23
Ear/Otic Placode
statoacoustic ganglion (SAG)
statoacoustic ganglion, SAG
25-30
stage 27
stage 27
stage 29
Ear/Otic Placode
 
31-37
stage 32
stage 35
stage 35
stage 37
Ear/Otic Placode
AC, anterior crista
CC, common crus
CD, cochlear duct
ED, endolymphatic duct
LC, lateral crista
PC, posterior crista
UM, utricular macula

Entry 7

GEISHA IdSLIT2.Schwend.2012Data SourcePublication
Complete cDNA Template Probeshow
ATGGTTTTACCTCGCACCAGCCCTTGTGATAATTATGAATGCCAAAATGGAGCCCAGTGTATTGTAAAGGAGAGTGAAC
CAATCTGCCAGTGTTTATCAGGCTACCAGGGTGAGAAATGTGAAAAGCTGATCAGTATAAACTTTGTCAACAAAGAATC
CTATCTACAAATCCCTTCAGCTAAGATACACTCCCAAACCAATATCACTCTTCAGATTGCCACAGACGA
CitationSchwend T, Lwigale PY, Conrad GW. Nerve repulsion by the lens and cornea during cornea innervation is dependent on Robo-Slit signaling and diminishes with neuron age. Dev Biol. 2012 Mar 1;363(1):115-27.
CopyrightCopyright © 2011 Elsevier Inc. All rights reserved.
CommentsThe cDNA template used to generate the probe was obtained by PCR as described in the paper.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
stage 27
stage 27
Eye
Lens
 
31-36
stage 36
stage 36
Eye
Lens
 

Entry 8

GEISHA IdSLIT2.Giovannone.2012Data SourcePublication
Complete cDNA Template Probeshow
GCCGCACCAGGACGAATCCGGGGGGGAGTCACGGCTGGGAGAGGAGCACGCGAAGGAGCCGGCGCTGCTGAAGCCGAGA
GCCGAGTGCCGCCCGTCCCCGCCATCCGACGGGTTACGGAGGGAGGGCCCGGCCAGGCCCCCTCCCCGCCAAGTTGCCT
TCAGCTGCGGATCGTTACCACCCGCCGTACTTTGCCGGGCTTGTTTGCTCGGCTCGGCTCTGGATAGAGAGGACTTCGC
TTTCTCCGCACCCTGAAAGTTGCCCGAGCGCTCCCCGCGGCGAGGTGGAAGAGGAGGGCGGCGCGCCCCGCGCCTCCCC
GGGCCCGAGGCCGGCGGGCCCCGGCCGGGCGCAGCGGGCGGCGATGATGTGCGCCTGGGGGAGGCTCCCCCTGGCCCTG
GGGCTGCTGCTGGTGCTGGCGGGCGAGGCGGCGCCGCAGCCGTGCCCGGCGCAGTGCTCCTGCTCAGGAAGCACGGTGG
ACTGTCACGGGCTGGCGCTGCGCGGCGTCCCGAGGAACATCCCCCGCAACACTGAGCGGCTGGACCTTAATGGAAATAA
CATCACCAGAATCACCAAGACCGACTTTGCTGGTCTAAGGCACCTTCGAGTTCTTCAGCTCATGGAGAACAAGATTAGC
ACTATTGAGAGAGGAGCATTCCAGGATTTAAAAGAACTGGAGAGGCTGCGCCTAAACAGAAATAACCTCCAGTTGCTTT
CTGAACTGCTCTTTCTGGGGACGCCGAAGTTATACAGGCTTGATCTTAGTGAAAATCAGATTCAAGCCATACCCAGGAA
GGCATTTCGTGGAGCAGTAGACATAAAAAATCTGCAACTGGATTACAACCAGATCAGCTGTATTGAAGATGGGGCATTT
AGGGCTCTACGCGACCTGGAAGTGCTCACTCTCAACAACAATAACATTACTCGACTGTCCGTCGCAAGTTTCAATCATA
TGCCCAAACTCAGAACTTTTCGCCTGCACTCCAACAACCTCTACTGTGACTGCCACCTGGCCTGGCTGTCGGACTGGCT
GCGGCAGCGGCCACGTGTAGGCCTCTACACTCAGTGCATGGGCCCAGCACACCTGCGGGGCCATAACGTGGCTGAGGTC
CAGAAGCGGGAGTTCGTCTGCAGTGGTCACCAATCATTTATGGCTCCATCCTGCAGTGTCTTGCATTGTCCTGCTGCAT
GCACCTGTAGTAACAACATTGTGGACTGTCGTGGGAAAGGCCTTACTGAAATTCCAACAAATCTTCCAGAAACCATTAC
TGAAATACGGTTAGAACAAAATTCAATCAAAGTCATACCTCCTGGAGCTTTCTCACCCTATAAAAAGCTTCGAAGAATT
GACCTGAGCAATAACCAGATCTCTGAAGCAGCTCCAGATGCTTTCCAGGGCTTACGTTCTCTCAATTCACTTGTCCTCT
ATGGCAATAAAATTACAGAACTTCCAAAAGGCCTATTTGAAGGACTGTTTTCTCTGCAATTGCTATTATTAAATGCCAA
CAAGATCAATTGCCTGCGTGTTGATGCTTTTCAAGATCTGCACAACTTGAATCTCCTATCTTTATATGACAACAAGCTT
CAGACCATTGCAAAAGGCACCTTTTCACCTCTACGTGCAATTCAGACCTTGCATTTGGCTCAGAACCCATTTATCTGTG
ACTGCCATCTGAAGTGGCTGGCGGATTATCTTCATACAAACCCCATTGAGACCAGTGGTGCCCGCTGCACCAGCCCCCG
CCGTCTGGCAAACAAAAGGATCGGCCAGATCAAAAGCAAGAAATTCCGCTGCTCAGCTAAAGAGCAGTATTTCATTCCA
GGCACTGAAGATTACAGATCCAAATTAAGTGGTGACTGCTTTGCAGATTTGGCTTGCCCTGAGAAATGTCGCTGTGAAG
GGACCACAGTGGACTGCTCCAATCAGAAACTCAACAAAATTCCTGATCACATCCCACAGTACACAGCAGAGTTGCGACT
CAATAACAATGAATTTTCAGTCCTGGAAGCTACTGGGATCTTTAAGAAGCTTCCTCAACTGCGAAAAATAAACCTGAGC
AATAACAAGATTACAGATATTGAAGAAGGTGCATTTGATGGAGCCTCTGGTGTCAATGAACTATTGCTCACTAGCAATC
GTTTGGAAACTGTTAGAGACAAAATGTTCAAAGGACTGGAAAGTCTTAAAACACTGATGCTGAGGAGTAACCGTGTGAG
CTGTGTGGGGAACGACAGTTTCACAGGCCTGAGCTCTGTCCGTCTGCTCTCACTATATGACAACCAGATCACCACCGTG
GCACCCGGCTCCTTCGATACCCTGCATTCACTCTCTACATTAAACCTCTTGGCCAATCCTTTCAACTGCAACTGCCATC
TTGCATGGCTTGGAGATTGGCTAAGGAAGAAACGCATTGTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAA
AGAGATTCCTATCCAGGATGTGGCAATTCAGGATTTTACATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTG
TCCCGCTGTCCTGCAGAATGTACTTGTCTAGACACAGTTGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAG
GCATCCCAAAAGATGTAACTGAACTATATTTGGATGGAAACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAA
ACATTTAACACTTATAGATTTAAGTAACAACAGAATCAGCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTG
CTCACCTTAATTCTTAGTTACAACCGCCTGAGGTGTATCCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGC
TGTCTTTACATGGCAATGATATTTCTGTGGTTCCTGAAGGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTAT
TGGAGCAAATCCTCTTTATTGTGATTGTAACATGCAATGGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGT
ATTGCACGATGTGCTGGCCCTGGAGAAATGGCAGATAAACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAG
GGCCCGTGGATGTCAATATTCTTGCTAAGTGTAACCCCTGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAA
TGATCCAGTTGACTTCTATAGATGTACTTGCCCATATGGTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGC
ATTAGTAACCCTTGCAACCATGGTGGAACTTGTCATTTGAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAG
ATGGATTTGAAGGAGAAAATTGTGAAATAAATGTTGATGACTGTGAAGACAATGACTGTGAAAATAACTCTACTTGTGT
GGATGGAATTAATAATTATACTTGCCTTTGTCCACCTGAATATACAGGTGAGCTCTGTGAGGAGAAACTAGATTTCTGT
GCTCAAAACCTGAACCCTTGCCAGCACGACTCAAAGTGTATCTTGACTCCCAAAGGTTACAAGTGTGATTGCACACCTG
GATATGTAGGTGAACACTGCGATATTGACTTCGATGACTGCCAGGACAATAAATGTAAAAACGGAGCACAGTGTACGGA
TGCAGTTAACGGGTATACTTGTATTTGCCCAGAGGGATACAGTGGCTTGTTTTGTGAGTTTTCGCCACCAATGGTTTTA
CCTCGCACCAGCCCTTGTGATAATTATGAATGCCAAAATGGAGCCCAGTGTATTGTAAAGGAGAGTGAACCAATCTGCC
AGTGTTTATCAGGCTACCAGGGTGAGAAATGTGAAAAGCTGATCAGTATAAACTTTGTCAACAAAGAATCCTATCTACA
AATCCCTTCAGCTAAGATACACTCCCAAACCAATATCACTCTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTC
TACAAAGGCGATAAGGATCATATAGCAGTAGAGCTGTACCGTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATC
CAGCCTCTGCTATTTACAGTGTGGAAACTATTAATGATGGCAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGAT
TCTGTCTTTGTCTATTGATGGAGGAAGCCCCAAGATAATTACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCT
CCACTGTATGTCGGAGGCATGCCTGTGAAAAATAACATTGCAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCT
TCCATGGCTGCATCCGTAATCTGTATATCAACAGCGAACTCCAGGACTTCAGAAATGTGCCACTGCAAGTGGGAATTCT
GCCAGGTTGCGAGCCTTGTCACAAGAAAGTTTGTGTGCATGGAACATGCCATGCTACCAGCCAGTCAAGCTTTACCTGT
GAGTGTGAAGGAGGATGGACTGGACCCCTCTGTGATCAACAAACTAATGACCCGTGTCTCGGAAATAAATGTGTGCATG
GTACCTGCTTGCCGATCAATGCATTTTCATACAGTTGTAAATGCCTGCAGGGACATGGGGGAGTCCTCTGTGATGAAGA
GGAAATGCTGTTTAACCCCTGCCAATCCATCAGGTGTAAACATGGCAAATGCAGGCTTTCAGGACTTGGGAAACCATAT
TGCGAATGCAGCAGCGGATACACGGGGGACAGCTGTGATAAAGAAATCTCTTGTCGAGGGGAACGAATCCGAGATTACT
ACCAAAAGCAGCAAGGGTATGCTGCGTGCCAGACGACCAAGAAGGTATCGAGACTAGAATGTAAAGGAGGATGTTCAAC
CGGGCAGTGCTGTGGACCACTAAGGAGCAAGAGACGGAAATACTCTTTTGAATGCACTGATGGGTCGTCATTTGTGGAC
GAGATTGAAAAAGTGGTGAAGTGTGGCTGTACAAATTGTCCCTCCTAAGTGTTCCTGTCACACTTGTCTTTTGAAAATG
TTGTATACTTATTGACCGTGTCGGACTAATTAATGCTTCATAGTGGAAATATTTGAAATATATTGTAAAATACAGAACA
GACTTATTTTTATTATGAGAATAAAGACTTTTTCTTCATTTGAAAAAAGATTCAAGTGCTTGAACTGAGACTTCTCATA
ATCAAGAGGAGCTTTGAAGAAAAAAAAAGACCTGGTAACATTGCAACAGTGATGGGAAACTTAACTACTTTTAACACGG
ATTCTTCTTTATAACATGCTGAAGATACACTGACACTATACATACTCGACTTTCAACTTAACAGCTCAGAGATGAAATG
TTGATCAGAACATGTGTCTTGTTTTTTCATTTTCGTATCAGTATATTTTATTGTCTTAACAGACCATACCAATCACTTA
CCTATGGATGAGGATGCATACAGAGATAATTATTGTATGAAGTACATTTTATCTTTCAGAATTATTAAGCATCTTGAGA
AGATGAGGTCCCATTTAGTGGATGGGAAATGGGAGATATGAGAATATACTATAATCCTGAAATCTCCTGATGATGTACA
CTTTTATGTCAGCATGTTAACAAAAGAAGCATACAAAAAGTGTTTATCTGCCCTTTTCCAGTATTAATTTTTTGTAATA
TAAATGTTTGGGGGATGATGAAAATAGATTATTGATGGATAAATTAGTAATAATATGGATTTCTGTTTCTATGAGTTCT
AAAAACAACTCTATACAGTATTCGGTTTCATTGAGAAATATTTATTGTATCGAAGTACATTGTACTTAACCCTCCTAGG
TCATCCCTTTTACTGTTTTTCAATGCTTTAATATATATTAATTTATATTTGTCCCAGTATTTTTGTATTTTTTTTTTAA
AGAAAAAGACTTAAAAATCAGGATTTTTTGCAATAGAACTAACGTAGCATGTCGTCTTGGGGTAAATGTTTTTGGTCTG
TTCCTCCCCATCCCTTTCTCCTTTTCTTTTCCTTAGAATCTGACCACTTGGTGTCGCTGAATCTGAAAGTGATGACAAT
CTGCAGTTTTCACGTACAGCAGATATTCAGGACACCTTCCAGGAACCTATACTGCGTGACAGAAAATGTCTTTTACACT
AGGTGGCAATTGTAGAGAAATTAATTTTCCCTATATACAGTACTTACAGAAAATGAGATGGCATGTAGAAAATGGCATT
AGAAGGTAGATCTTTATAAATTAATATTCCCATGGAGCCCTTTACCTTTTTTTTATAAAGAAAAAAAGAAAAAAAGGCT
GTGCTATCAAGAACTGTGACTTTCCCCAAATAATAAAGCTACTTTACTGCCCTAATGTTCCCCACGTTAACATGTTGCT
GCTAAATTATAATGTAGAATTGGTAATCATTAATAGTGGGTTGTGTTCTTCTTTCAGTAAAACCCAGGGTACCCTGTAA
AAATGCAGATGTTTTTCAATTTTATTTTATTATTTTTTTTACAAAAAAAAGTTAGGTGTACATGTGTAATGCAGTGTGC
TTTGTCTTATTTGGACTGATATCAGTAATGCTACTGATGTTTGTAAATTAAACAGATATTTACTTCA
CitationGiovannone D, Reyes M, Reyes R, Correa L, Martinez D, Ra H, Gomez G, Kaiser J, Ma L, Stein MP, de Bellard ME. Slits affect the timely migration of neural crest cells via Robo receptor. Dev Dyn. 2012 Aug;241(8):1274-88.
CopyrightCopyright © 2012 Wiley Periodicals, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_001267075.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
Central Nervous System
Eye
Neural Plate/Tube
Section of Fig. 1B.

Entry 9

GEISHA IdSlit2.Vargesson.2001Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
TGGAGCCTCTGGTGTCAATGAACTATTGCTCACTAGCAATCGTTTGGAAACTGTTAGAGACAAAATGTTCAAAGGACTG
GAAAGTCTTAAAACACTGATGCTGAGGAGCAACCGTGTGAGCTGTGTGGGGAACGACAGTTTCACAGGCCTGAGCTCTG
TCCGCCTGCTCTCACTGTATGACAACCAGATCACCACCGTGGCACCCGGCTCCTTCGATACCCTGCATTCACTCTCTAC
ATTAAACCTCTTGGCCAATCCTTTCAACTGCAACTGCCATCTTGCATGGCTTGGAGATTGGCTAAGGAAGAAACGCATT
GTGACGGGAAACCCTCGCTGTCAGAAACCTTATTTCCTCAAAGAGATTCCTATCCAGGATGTGGCAATTCAGGATTTTA
CATGTGATGATGGAAATGATGACAATAGCTGCTCTCCGCTGTCCCGCTGTCCTGCAGAATGTACTTGTCTAGACACAGT
TGTTCGCTGCAGCAACAAAGGCCTAAAAGCTTTGCCTAAAGGCATCCCAAAAGATGTAACTGAACTATATTTGGATGGA
AACCAGTTTACTCTTGTTCCTAAAGAGCTCTCCAACTACAAACATTTAACACTTATAGATTTAAGTAACAACAGAATCA
GCACTCTTTCTAATCAGAGCTTCAGCAACATGACTCAGCTGCTCACCTTAATTCTTAGTTACAACCGCCTGAGGTGTAT
CCCTGCACGGACTTTTGATGGGTTGAAATCACTTAGGTTGCTGTCTTTACATGGCAATGATATTTCTGTGGTTCCTGAA
GGAGCCTTTAATGATCTTTCAGCGTTATCACACCTGGCTATTGGAGCAAATCCTCTTTATTGTGATTGTAACATGCAAT
GGCTGTCTGACTGGGTAAAATCAGAATACAAAGAACCTGGTATTGCACGATGTGCTGGCCCTGGAGAAATGGCAGATAA
ACTTCTACTTACAACTCCATCTAAAAAATTTACTTGCCAAGGGCCCGTGGATGTCAATATTCTTGCTAAGTGTAACCCC
TGCTTATCAAATCCATGTAAAAATGATGGAACCTGCAATAATGATCCAGTTGACTTCTATAGATGTACTTGCCCATATG
GTTTCAAGGGTCAAGACTGTGATATTCCCATTCATGCCTGCATTAGTAACCCTTGCAACCATGGTGGAACTTGTCATTT
GAAAGAAGGAGAAAAAGATGGTTTCTGGTGCACTTGTGCAGATGGATTTGAAGGAGAAAATTGTGAAATAAATGTTGAT
GACTGTGAAGACAATGACTGTGAAAATAACTCGACTTGTGTAGATGGAATTAATAATTATACTTGCCTTTGTCCACCTG
AATATACAGGTGAGCTCTGTGAGGAGAAACTAGATTTCTGTGCTCAAAACCTGAATCCTTGCCAGCACGACTCAAAGTG
TATCTTGACTCCCAAAGGTTACAAGTGTGATTGCACACCTGGATATGTAGGTGAACACTGCGATATTGACTTCGATGAC
TGCCAGGACAATAAATGTAAAAACGGAGCACAGTGTACGGATGCAGTTAACGGGTATACTTGTATTTGCCCAGAGGGAT
ACAGTGGCTTGTTTTGTGAGTTTTCGCCACCAATGGTTTTACCTCGCACCAGCCCTTGTGATAATTATGAATGCCAAAA
TGGAGCCCAGTGTATTGTAAAGGAGAGTGAACCAATCTGCCAGTGTTTATCAGGCTACCAGGGTGAGAAATGTGAAAAG
CTGATCAGTATAAACTTTGTCAACAAAGAATCCTATCTACAAATCCCTTCAGCTAAGATACACTCCCAAACCAATATCA
CTCTTCAGATTGCCACAGACGAAGACAGTGGGATCCTGCTCTACAAAGGCGATAAGGATCATATAGCAGTAGAGCTGTA
CCGTGGTAGAGTGAGGGTCAGTTATGACACAGGATCTTATCCAGCCTCTGCTATTTACAGTGTGGAAACTATTAATGAT
GGCAATTTCCACATTGTGGAGCTGCTTGCCATGGATCAGATTCTGTCTTTGTCTATTGATGGAGGAAGCCCCAAGATAA
TTACCAATTTGTCCAAGCAGTCCACTTTGAATTTTGATTCTCCACTGTATGTCGGAGGCATGCCTGTGAAAAATAACAT
TGCAGCTCTACGTCAGTCTCCAGGACAGAATGGCACAAGCTTCCATGGCTGCATCCGTAATCTGTATATCAACAGCGAA
CTCCAGGACTTCAGAAATGTGCCACTGCAAGTGGGAATTCTGCCAGGTTGCGAGCCTTGTCACAAGAAAGTTTGTGTGC
ATGGAACATGCCATGCTACCAGCCAGTCAAGCTTTACCTGTGAGTGTGAAGGAGGATGGACTGGACCCCTCTGTGATCA
ACAAACTAATGACCCGTGTCTCGGAAATAAATGTGTGCATGGTACCTGCTTGCCGATCAATGCATTTTCATACAGTTGT
AAATGCCTGCAGGGACATGGGGGAGTCCTCTGTGATGAAGAGGAAATGCTGTTTAACCCCTGCCAATCCATCAGGTGTA
AACATGGCAAATGCAGGCTTTCAGGACTTGGGAAACCATATTGCGAATGCAGCAGCGGATACACGGGGGACAGCTGTGA
TAAAGAAATCTCTTGTCGAGGGGAACGAATCCGAGATTACTACCAAAAGCAGCAAGGGTATGCTGCGTGCCAGACGACC
AAGAAGGTATCGAGACTAGAATGTAAAGGAGGATGTTCAACCGGGCAGTGCTGTGGACCACTAAGGAGCAAGAGACGGA
AATACTCTTTTGAATGCACTGATGGGTCGTCATTTGTGGACGAGATTGAAAAAGTGGTGAAGTGTGGCTGTACAAATTG
TCCCTCCTAAGTGTTCCTGTCACACTTGTCTTTTGAAAATGTTGTATACTTATTGACCGTGTCGGACTAATTAATGCTT
CATAGTGGAAATATTTGAAATATATTGTAAAATACAGAACAGACTTATTTTTATTATGAGAATAAAGACTTTTTCTTCA
TTTGAAAAAAGATTCAAGTGCTTGAACTGAGACTTCTCATAATCAAGAGGAGCTTTGAAGAAAAAAAAAGACCTGGTAA
CATTGCAACAGTGATGGGAAACTTAACTACTTTTAACACGGATTCTTCTTTATAACATGCTGAAGATACACTGACACTA
TACATACTCGACTTTCAACTTAACAGCTCAGAGATGAAATGTTGATCAGAACATGTGTCTTGTTTTTTCATTTTCGTAT
CAGTATATTTTATTGTCTTGACAGACCATACCAATCACTTACCTATGGATGAGGATGCATACAGAGATAATTATTGTAT
GAAGTACATTTTATCTTTCAGAATTATTAAGCATCTTGAGAAGATGAGGTCCCATTTAGTGGATGGGAAATGGGAGATA
TGAGAATATACTATAATCCTGAAATCTCCTGATGATGTACACTTTTATGTCAGCATGTTAACAAAAGAAGCATACAAAA
AGTGTTTATCTGCCCTTTTCCAGTATTAATTTTTTGTAATATAAATGTTTGGGGGATGATGAAAATAGATTATTGATGG
ATAAATTAGTAATAATATGGATTTCTGTTTCTATGAGTTCTAAAAACAACTCTATACAGTATTCGGTTTCATTGAGAAA
TATTTATTGTATCGAAGTACATTGTACTTAACCCTCCTAGGTCATCCCTTTTACTGTTTTTCAATGCTTTAATATATAT
TAATTTATATTTGTCCCAGTATTTTTGTATTTTTTTTTTAAAGAAAAAGACTTAAAAATCAGGATTTTTTGCAATAGAA
CTAACGTAGCATGTCGTCTTGGGGTAAATGTTTTTGGTCTGTTCCTCCCCATCCCTTTCTCCTTTTCTTTTCCTTAGAA
TCTGACCACTTGGTGTCGCTGAATCTGAAAGTGATGACAATCTGCAGTTTTCACGTACAGCAGATATTCAGGACACCTT
CCAGGAACCTATACTGTGTGACAGAAAATGTCTTTTACACTAGGTGGCAATTGTAGAGAAATTAATTTTCCCTATATAC
AGTACTTACAGAAAATGAGATGGCATGTAGAAAATGGCATTAGAAGGTAGATCTTTATAAATTAATATTCCCATGGAGC
CCTTTACCTTTTTTTTTATAAAGAAAAAAAGAAAAAAAGGCTGTGCTATCAAGAACTGTGACTTTCCCCAAATAATAAA
GCTACTTTACTGCCCTAATGTTCCCCACGTTAACATGTTGCTGCTAAATTATAATGTAGAATTGGTAATCATTAATAGT
GGGTTGTGTTCTTCTTTCAGTAAAACCCAGGGTACCCTGTAAAAATGCAGATGTTTTTCAATTTTATTTTATTATTTTT
TTTACAAAAAAAAGTTAGGTGTACATGTGTAATGCAGTGTGCTTTGTCTTATTTGGACTGATATCAGTAATGCTACTGA
TGTTTGTAAATTAAACAGATATTTACTTCAAAA
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Vargesson et al. 2001.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 24
Leg AER
Limb Buds
Paraxial Mesoderm
 
25-30
stage 26
stage 28
Limb Buds
 
31-44
stage 32
stage 44
stage 44
Limb Buds
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.39631

Mouse

EmageMGI:1315205
EurexpressMGI:1315205
MGI GXDMGI:1315205

Frog

Xenbase1004409

Fruit Fly

BDGPFBgn0264089

Zebra Finch

ZEBrASLIT2

Zebrafish

ZFINZDB-GENE-010306-3
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona