GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SOX11
SRY-box 11

Gene
Official SymbolSOX11
Official Full NameSRY-box 11
CGNC ID12274
also known astranscription factor SOX-11|SRY (sex determining region Y)-box 11|Sox11 transcription factor|cSox11, Sox11, Gallus gallus SRY (sex determining region Y)-box 11 (SOX11)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205187
PolypeptideNP_990518
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.32193
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human6664ENSG00000176887MIM:600898
Mouse20666All phenotypic alleles (2):Targeted, other(2) MGI:98359
Xenopus493415, 399440, 100216330483417
Zebrafish30602, 30603ENSDARG00000077811, ENSDARG00000095743ZDB-GENE-980526-395, ZDB-GENE-980526-466ZFIN:ZDB-GENE-980526-395, ZFIN:ZDB-GENE-980526-466
Gene Ontology
Molecular FunctionDNA binding
Biological Processcell differentiation, nervous system development, positive regulation of canonical Wnt signaling pathway, more...regulation of transcription, DNA-templated, transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene396104
Ensembl Gene
KEGGgga:396104
GEISHA IdSox11.Logan.2002Data SourcePublication
Complete cDNA Template Probeshow
TGATAAAGGCGGTGGGCTGGGCGACGGCGGGGGCCGGGCGCAACCATTGGCGTTGCCGGGAGTGATGTCACCCATATGA
AACGCTGATAACGCGTCGGGTGCGGAGCCGCGAGTTTTGCAGAAGGGGCAGCGCGCGCGGCGGGGCTAGGCGGGCCGGC
GGCGAGGCCGGGGCAGAGCGCGGCGCCCAGCACAGCCCAGCCGCGCCCAGCCCCAGCCCGGCCGTGCCGAGCCGTGCTG
CGCTGCGGGCAGAGGTCCCCCGGCCGGCGGTACGGTACAGCGCAGCGCCCGGTTCGCAGGGCAAGGTGCGGCGGTGGGA
GGGGGCGGCGGTCGGCGCGGAGCGGAGCGCCGCGGGGGAGCCCAGCGATGGTACAGCAGGCGGAGAGCGCGGAGAGCGA
GAGCAACCTGCCCCGGGAGGCGATGGACACCGAAGAGGGCGAGTTCATGGCTTGCAGCCCGGTGGCTCTGGACGAGAGC
GATCCGGACTGGTGCAAAACGGCGTCGGGGCACATCAAGCGACCGATGAACGCTTTCATGGTGTGGTCTAAGATCGAGA
GGAGAAAAATCATGGAGCAGTCGCCGGACATGCACAACGCGGAGATCTCCAAGCGCCTGGGCAAGCGGTGGAAAATGCT
GAAGGACAGCGAGAAGATCCCCTTCATCCGGGAGGCGGAGAGGCTGCGGCTCAAGCACATGGCCGATTACCCCGACTAC
AAGTACCGGCCCAGGAAAAAGCCCAAAATGGACCCCTCGGCCAAGCCCAACGCCGGCCAGAGCCCCGAGAAGAACGCTC
CCGGCGGCGGCAGCAAGAGCGCCAAGAGCTCGGGCAAGAAGTGCAGCAAGCTGAAGGCCGCCGCCGCCTCGCCCCCCAA
GCCCGGCGCCAAAGCCGCCCCTCACGGGGACTACGCGGGGGACGAGTACGTCTTCGGCGCGCTGAAAGTCAGCAGCAAG
GCGGTCAAGTGCGTTTTCGTGGACGAGGAGGAGGAGGACGAGGAGGACGAGGACGAGCTGCAGCTGCGGATCAAGCAGG
AGGCGGACGACGAGGAGGAGGACGAGGAGCCGGGCCCGCAGCAGCTGCGGCGGTACAACGTGGCCAAAGTGCCGGCCAG
CCCCACCTTGAGCTCCTCGGCGGAGTCCACCGAGGGGGCGAGCCTCTACGAGGAGGTGCGGGGCGCGGCGGGCGGCGGC
AGACTCTACTACAGCTTCAAGAACATCACCAAGCAGGGCCCGCCGCCGCCGCAGCCGCCCGCCGGCCTCTCCCCCGCCT
CCGTCCCGCTCCATCTCCACCTCGTCGGCCGGCAGCGAGGAGGCGGACGACCTCCTGTTCGACCTCAGCCTCAACTTCT
CGCAGCATGGCCACGCCGCCGCCGAGCTGGGGGCGGGGCCGCCGCCGGCAACCTCTCCCTCTCGCTGGTGGACAAGGAC
CTGGACTCGTTCAGCGAGGGCAGCCTCGGCTCCCACTTCGAGTTCCCCGACTACTGCACCCCGGAGCTGAGCGAGATGA
TCGCGGGCGACTGGCTGGAGGCCAACTTCTCCGACCTGGTGTTCACGTACTGAGCGGGCGGAGGCGGCGACGGGAGCGG
CGGATGCCGTGGTGATGGTGGTGGTGGTGGTGGTGATGATGATGATGCTTAAAAAGAAAAGCTCTTTAAAAAAAAAAAA
AAAAAATCCTGATGTTAGTTCGAGCCCGGAGTTGTGAATTTTTTTTTTAATTTTTAATTTTTTTGTGTGTTTTTTTTTT
TTGTTACATTTGGTGATCACAACAACAACAGCAAAGGGAAATGGGAATGGGGGAAAAATGCTACAGAAGGGCGCTGTTC
GAAGCTTGGCGGTCTCTGATGGAAGGCTGGAAGATGGTCTGCGAAGAAGTCTTTTGGCAGCACAACTGTTACTCAAGGG
GGTTTGTGGATTTTTTTTTTTTTTCCCGTGAGAGATCTTAAAGAACTGTTCTGATTTTTTTAATTATTTTTTATTTTTT
CC
CitationLogan, C, Millar, C, Bharadia, V, Rouleau, K. Onset of Tlx-3 expression in the chick cerebellar cortex correlates with the morphological development of fissures and delineates a posterior transverse boundary. J Comp Neurol. 2002 Jun 24;448(2):138-49.
CopyrightOnset of Tlx-3 expression in the chick cerebellar cortex correlates with the morphological development of fissures and delineates a posterior transverse boundary, Logan, C, Millar, C, Bharadia, V, and Rouleau, K; Copyright © (2002 Wiley-Liss); This material is used by permission of Wiley-Liss, Inc., a subsidiary of John Wiley & Sons, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize the 2kb probe. The sequence below was obtained from NCBI (acc # NM_205187.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-40
stage 38
stage 40
Midbrain
cerebellum
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.32193

Mouse

EmageMGI:98359
EurexpressMGI:98359
MGI GXDMGI:98359

Frog

Xenbase483417

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-395, ZDB-GENE-980526-466
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona