GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TBX3
T-box 3

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolTBX3
Official Full NameT-box 3
CGNC ID49082
also known asT-box transcription factor TBX3|T-Box protein 3, T-box transcription factor TBX3, T-box protein 3, Tbox3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001270878
PolypeptideNP_001257807
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.27708
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human6926ENSG00000135111MIM:181450MIM:601621
Mouse21386ENSMUSG00000018604All phenotypic alleles (4):Targeted, knock-out(3) Targeted, other(1) MGI:98495
Xenopus613116, 397816, 3736121018230
Zebrafish556870ENSDARG00000002216ZDB-GENE-070209-80, ZDB-GENE-060531-144ZFIN:ZDB-GENE-070209-80, ZFIN:ZDB-GENE-060531-144
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity
Biological Processanterior/posterior axis specification, embryo, cell aging, embryonic digit morphogenesis, more...embryonic forelimb morphogenesis, female genitalia development, follicle-stimulating hormone secretion, luteinizing hormone secretion, male genitalia development, mesoderm morphogenesis, negative regulation of apoptotic process, negative regulation of myoblast differentiation, negative regulation of transcription, DNA-templated, positive regulation of cell cycle, positive regulation of cell proliferation, skeletal system development, transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene374202
Ensembl Gene
KEGGgga:374202

Entry 1

GEISHA Idpgm2n.pk008.e12Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CAGAGACTGCTATCCCCTTTTCTTCCCTGGGCCACCAGGCAGCAGCCCATCTGAGGCCTTTAAAAACTCTGGAGCCAGA
GGAAGAAGTGGAAGACGACCCGAAAGTGCACCTGGAAGCCAAAGAGCTTTGGGAACAATTCCATAAAAGAGGCACGGAG
ATGGTGATCACCAAATCGGGAAGGAGAATGTTTCCTCCGTTTAAAGTGAGATGCACTGGACTGGATAAAAAGGCCAAGT
ACATTTTATTGATGGATATTGTGGCGGCTGACGACTGTAGGTACAAATTCCATAATTCCCGGTGGATGGTAGCCGGCAA
AGCTGACCCTGAAATGCCAAAGAGAATGTACATCCACCCGGACAGCCCGGCCACCGGAGAACAATGGATGTCCAAAGTC
GTCACCTTTCACAAGCTGAAGCTCACTAACAACATCTCCGACAAGCACGGATTTACCATTTTAAACTCCATGCACAAGT
ACCAGCCCCGCTTCCACATCGTCCGAGCGAACGATATTCTCAAGCTTCCCTACAGCACGTTCCGGACCTACGTGTTCCC
GGAGACTGAATTCATCGCAGTGACCGCATACCAGAATGATAAGATCACTCAATTAAAAATTGACAACAACCCCTTTGCC
AAAGGTTTTCGCGACACTGGGAATGGAAGGAGGGAAAAAAGGAAGCAGCTGACCCTGCAGTCCATGCGGGTGTACGACG
AGAGGCAGAAGAAAGAAAACCCCACTTCGGACGAATCGTCCAACGAGCAGACAGCCTTCAAGTGCTTCGCGCAGTCCTC
CTGCCCCGCCGTGCCCGCCGTCGGCACCTCCAGCCNTCAAGATCTCTGTCCCAGCGA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 5
stage 6
Early Endoderm
Early Mesoderm
Extraembryonic Mesoderm
Headfold
Primitive Streak
extraembryonic endoderm
extraembryonic mesoderm
 

Entry 2

GEISHA IdTBX3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGCTGTTAGAAACCACTCCAGGAC
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGTTGAAGGCTGTCTGCTCGTTGGcDNA Template Length1045
Forward cDNA Template Probeshow
ANAAAATCGTCCGAAGTGGGGTTTTCTTTCTTCTGCCTCTCGTCGTACACCCGCATGGATTGCAGGGGTCAGCTGCTTC
CTTTTTTCCCTCCTTCCATTCCCAGTGTCGCGAAAACCTTTGGCAAAGGGGTTGTTGTCAATTTTTAATTGAGTGATCT
TATCATTCTGGTATGCGGTCACTGCGATGAATTCAGTCTCCGGGAACACGTAGGTCCGGAACGTGCTGTAGGGAAGCTT
GAGAATATCGTTCGCTCGGACGATGTGGAAGCGGGGCTGGTACTTGTGCATGGAGTTTAAAATGGTAAATCCGTGCTTG
TCGGAGATGTTGTTAGTGAGCTTCAGCTTGTGAAAGGTGACGACTTTGGACATCCATTGTTCTCCGGTGGCCGGGCTGT
CCGGGTGGATGTACATTCTCTTTGGCATTTCAGGGTCAGCTTTGCCGGCTACCATCCACCGGGAATTATGGAATTTGTA
CCTACAGTCGTCAGCCGCCACAATATCCATCAATAAAATGTACTTGGCCTTTTTATCCAGTCCAGTGCATCTCACTTTA
AACGGAGGAAACATTCTCCTTCCCGATTTGGTGATCACCATCTCCGTGCCTCTTTTATGGAATTGTTCCCAAAGCTCTT
TGGCTTCCANGTGCACTTTCNGGTCNTCTTCCACTTCTTCCTCTGGCTCCANANTTTTTAAANGCCNCANATGGNCTGC
TGCCTGGNGNCCCANGNAANAAAANGNNANANCNNNCNCNNCNNCCCCCAC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Amnion
Anterior Intestinal Portal
Ectoderm
Foregut
Hensen's Node
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
 
13-18
stage 13
stage 13
stage 13
stage 13
stage 13
stage 13
stage 14
stage 14
stage 15
stage 15
stage 15
stage 15
stage 15
Amnion
Anterior Intestinal Portal
Ear/Otic Placode
Ectoderm
Endoderm
Extraembryonic
Eye
Face Mesenchyme
Foregut
Head Mesenchyme
Hensen's Node
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Notochord
Oral Pharynx
Pharyngeal Arches and Clefts
Somatic Mesoderm
Somites
Tail
extraembryonic ectoderm
 
19-24
stage 20
stage 20
stage 23
stage 23
Ear/Otic Placode
Eye
Face Mesenchyme
Leg Mesenchyme
Midgut
Nasal Placode/Nerve
Oral Pharynx
Pharyngeal Arches and Clefts
Somatic Mesoderm
Spinal Ganglia and Nerves
Valves
Wing Mesenchyme
Low level expression in heart valve and midgut.
25-26
stage 25
stage 25
stage 25
stage 26
stage 26
stage 26
stage 26
stage 26
Ear/Otic Placode
Eye
Leg Mesenchyme
Lung
Midgut
Nasal Placode/Nerve
Oral Pharynx
Pharyngeal Arches and Clefts
Somatic Mesoderm
Spinal Ganglia and Nerves
Valves
Wing Mesenchyme
 

Entry 3

GEISHA IdTbx3.Yamada.2000Data SourcePublication
Complete cDNA Template Probeshow
ATGGCTTATCATCCTTTTTTACCTCACCGGGCACCGGACTTTGCCATGAGTGCCGTGCTGGGACATCAGCCCCCCTTCT
TCCCGGCCCTGGCTTTGCCCCCCAATGGGGCGGCCGCCCTCTCCCTCCCCGGCGCCCTGGCTAAGCCCATTATGGATCA
GCTAGTGGGGGCTGCAGAGACTGCTATCCCCTTTTCTTCCCTGGGCCACCAGGCAGCAGCCCATCTGAGGCCTTTAAAA
ACTCTGGAGCCAGAGGAAGAAGTGGAAGACGACCCGAAAGTGCACCTGGAAGCCAAAGAGCTTTGGGAACAATTCCATA
AAAGAGGCACGGAGATGGTGATCACCAAATCGGGAAGGAGAATGTTTCCTCCGTTTAAAGTGAGATGCACTGGACTGGA
TAAAAAGGCCAAGTACATTTTATTGATGGATATTGTGGCGGCTGACGACTGTAGGTACAAATTCCATAATTCCCGGTGG
ATGGTAGCCGGCAAAGCTGACCCTGAAATGCCAAAGAGAATGTACATCCACCCGGACAGCCCGGCCACCGGAGAACAAT
GGATGTCCAAAGTCGTCACCTTTCACAAGCTGAAGCTCACTAACAACATCTCCGACAAGCACGGATTTACCATTTTAAA
CTCCATGCACAAGTACCAGCCCCGCTTCCACATCGTCCGAGCGAACGATATTCTCAAGCTTCCCTACAGCACGTTCCGG
ACCTACGTGTTCCCGGAGACTGAATTCATCGCAGTGACCGCATACCAGAATGATAAGATCACTCAATTAAAAATTGACA
ACAACCCCTTTGCCAAAGGTTTTCGCGACACTGGGAATGGAAGGAGGGAAAAAAGGAAGCAGCTGACCCTGCAATCCAT
GCGGGTGTACGACGAGAGGCAGAAGAAAGAAAACCCCACTTCGGACGAATCGTCCAACGAGCAGACAGCCTTCAAGTGC
TTCGCGCAGTCCTCCTGCCCCGCCGTGCCCGCCGTCGGCACCTCCAGCCTCAAAGATCTCTGTCCCAGCGAGGGTGACA
GCGATGCCGACAGCAAAGACGACCCTTTGCTAGAAGCCAGCGAGTCGGGCAAAATCAGCACGACCACGGCCACCACCCC
CGCGCCAGCCAGCTCCGGGGCGGCCGCGAGTGACGACCCTCGGGACAAAGGGGGCAGCCCTTCCAAAAGCCACTTCTTC
CCCAGCGACTCGGCGACGAGCCGGAGCCGGGAGAGGACGGAAAAGGCCCCCCCGGACTCCAGGCACAGCCCGGCCACCA
TCTCCTCCAGCAGCCGGGGGGGAGGCTTGAGCGGCGAGGAACTGAAAAGCCCCCTCCGGGACGGCCCTAAAGTAGACGA
GAACCGGCTGCTGGCGGGCATCGCGCTGCTGCTGCACCCCGGGCAGTTCGCTATGGGGGGGGCTTTGTCCGGCAAGGCC
GCGGGCATGGGTCTGCTGCTCGCCACGGTGTCGGGGGCTTCCGCCGGCGGCTCGGGACTGGACAGCACGGTGATGCCCA
CAGAGGCGGCCCAGGGACTCTCGGGGGCATCAACATCCGCTCTGCCCTTCCACCTGCAGCAGCACGTCCTGGCCTCTCA
GGGCTTGGCCATGTCCCCCTTCGGCAGCCTCTTCCCCTACCCCTACACCTACATGGCGGCGGCGGCGGCGGCTTCCAGC
GCGGCCTCCAATTCTGTGCACCGGCATCCCTTCCTCAACGCCGTGCGGCCCCGGCTCCGCTACAGCCCCTACCCGTTGC
CCGTGCCCCTGCCCGACGGCAGCAGCCTCCTCACCACCGCAATGCCCGGGGCCCTGGCCGCGACCTCCGGAGAGACCAA
AGGCAGCGCTCTGGCCTCCAGTCCCGGCGCCGTGCCCCTGGACTCCGCCTCGGACCTCACCAGTCGCTCGTCCACGCTC
TCCTCCGGCTCCGTATCCCTGTCCCCAAAGCTGGGAGCCGACAAGGAGGCGGCCACCAGCGAACTGCAGAACATCCAGC
GCCTGGTCAGCGGCCTCGACCCCAAGCAGGACAGATCTCGCAGTGGCTCCCCGTTGCGGGCCGCACATCGTTGGAAAAT
CAACCTACTGATAACGGAACACGAAGTGTATGTTTATGTCGCACAGGAAATCCCTTTCAACTCAACTGAGACACCAGAG
ATAGAGGATTACTCGTTGTATAATCCCCCTAATCCTAATGAGATACGATATCGAAACGCATAA
CitationYamada M, Revelli JP, Eichele G, Barron M, Schwartz RJ. Expression of chick Tbx-2, Tbx-3, and Tbx-5 genes during early heart development: evidence for BMP2 induction of Tbx2. Dev Biol. 2000 Dec 1;228(1):95-105.
CopyrightReprinted with permission from Elsevier. Copyright © 2000 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_001234534).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Lateral Plate Mesoderm
Precardiogenic mesoderm
7-12
stage 8
stage 10
Heart Tube
Primitive Streak
Veins
Precardiogenic mesoderm
Vitellin Veins
19-20
stage 20
 Figure 1 compares expression patterns of Tbx2, Tbx3, Tbx5 and bmp2 in early chick embryos. Figure includes HH stages 5-8, 10, 11, 16, 19 and 20.

Entry 4

GEISHA IdTBX3.Tumpel.2002Data SourcePublication
Complete cDNA Template Probeshow
ATGGCTTATCATCCTTTTTTACCTCACCGGGCACCGGACTTTGCCATGAGTGCCGTGCTGGGACATCAGCCCCCCTTCT
TCCCGGCCCTGGCTTTGCCCCCCAATGGGGCGGCCGCCCTCTCCCTCCCCGGCGCCCTGGCTAAGCCCATTATGGATCA
GCTAGTGGGGGCTGCAGAGACTGCTATCCCCTTTTCTTCCCTGGGCCACCAGGCAGCAGCCCATCTGAGGCCTTTAAAA
ACTCTGGAGCCAGAGGAAGAAGTGGAAGACGACCCGAAAGTGCACCTGGAAGCCAAAGAGCTTTGGGAACAATTCCATA
AAAGAGGCACGGAGATGGTGATCACCAAATCGGGAAGGAGAATGTTTCCTCCGTTTAAAGTGAGATGCACTGGACTGGA
TAAAAAGGCCAAGTACATTTTATTGATGGATATTGTGGCGGCTGACGACTGTAGGTACAAATTCCATAATTCCCGGTGG
ATGGTAGCCGGCAAAGCTGACCCTGAAATGCCAAAGAGAATGTACATCCACCCGGACAGCCCGGCCACCGGAGAACAAT
GGATGTCCAAAGTCGTCACCTTTCACAAGCTGAAGCTCACTAACAACATCTCCGACAAGCACGGATTTACCATTTTAAA
CTCCATGCACAAGTACCAGCCCCGCTTCCACATCGTCCGAGCGAACGATATTCTCAAGCTTCCCTACAGCACGTTCCGG
ACCTACGTGTTCCCGGAGACTGAATTCATCGCAGTGACCGCATACCAGAATGATAAGATCACTCAATTAAAAATTGACA
ACAACCCCTTTGCCAAAGGTTTTCGCGACACTGGGAATGGAAGGAGGGAAAAAAGGAAGCAGCTGACCCTGCAATCCAT
GCGGGTGTACGACGAGAGGCAGAAGAAAGAAAACCCCACTTCGGACGAATCGTCCAACGAGCAGACAGCCTTCAAGTGC
TTCGCGCAGTCCTCCTGCCCCGCCGTGCCCGCCGTCGGCACCTCCAGCCTCAAAGATCTCTGTCCCAGCGAGGGTGACA
GCGATGCCGACAGCAAAGACGACCCTTTGCTAGAAGCCAGCGAGTCGGGCAAAATCAGCACGACCACGGCCACCACCCC
CGCGCCAGCCAGCTCCGGGGCGGCCGCGAGTGACGACCCTCGGGACAAAGGGGGCAGCCCTTCCAAAAGCCACTTCTTC
CCCAGCGACTCGGCGACGAGCCGGAGCCGGGAGAGGACGGAAAAGGCCCCCCCGGACTCCAGGCACAGCCCGGCCACCA
TCTCCTCCAGCAGCCGGGGGGGAGGCTTGAGCGGCGAGGAACTGAAAAGCCCCCTCCGGGACGGCCCTAAAGTAGACGA
GAACCGGCTGCTGGCGGGCATCGCGCTGCTGCTGCACCCCGGGCAGTTCGCTATGGGGGGGGCTTTGTCCGGCAAGGCC
GCGGGCATGGGTCTGCTGCTCGCCACGGTGTCGGGGGCTTCCGCCGGCGGCTCGGGACTGGACAGCACGGTGATGCCCA
CAGAGGCGGCCCAGGGACTCTCGGGGGCATCAACATCCGCTCTGCCCTTCCACCTGCAGCAGCACGTCCTGGCCTCTCA
GGGCTTGGCCATGTCCCCCTTCGGCAGCCTCTTCCCCTACCCCTACACCTACATGGCGGCGGCGGCGGCGGCTTCCAGC
GCGGCCTCCAATTCTGTGCACCGGCATCCCTTCCTCAACGCCGTGCGGCCCCGGCTCCGCTACAGCCCCTACCCGTTGC
CCGTGCCCCTGCCCGACGGCAGCAGCCTCCTCACCACCGCAATGCCCGGGGCCCTGGCCGCGACCTCCGGAGAGACCAA
AGGCAGCGCTCTGGCCTCCAGTCCCGGCGCCGTGCCCCTGGACTCCGCCTCGGACCTCACCAGTCGCTCGTCCACGCTC
TCCTCCGGCTCCGTATCCCTGTCCCCAAAGCTGGGAGCCGACAAGGAGGCGGCCACCAGCGAACTGCAGAACATCCAGC
GCCTGGTCAGCGGCCTCGACCCCAAGCAGGACAGATCTCGCAGTGGCTCCCCGTTGCGGGCCGCACATCGTTGGAAAAT
CAACCTACTGATAACGGAACACGAAGTGTATGTTTATGTCGCACAGGAAATCCCTTTCAACTCAACTGAGACACCAGAG
ATAGAGGATTACTCGTTGTATAATCCCCCTAATCCTAATGAGATACGATATCGAAACGCATAA
CitationTümpel S, Sanz-Ezquerro JJ, Isaac A, Eblaghie MC, Dobson J, Tickle C. Regulation of Tbx3 Expression by Anteroposterior Signalling in Vertebrate Limb Development. Dev Biol. 2002 Oct 15;250(2):251-62.
CopyrightCopyright © 2002 Elsevier Science (USA). All rights reserved.
CommentsAccording to authors, "Chicken Tbx3 was a gift (Ref.)." As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI ( acc # XM_001234534).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 17
Lateral Plate Mesoderm
Leg Mesenchyme
Tail
Wing
Wing Mesenchyme
 
19-24
stage 19
stage 19
stage 20
stage 21
stage 22
stage 22
stage 23
stage 24
Lateral Plate Mesoderm
Leg
Leg AER
Leg Mesenchyme
Limb Buds
Wing
Wing Mesenchyme
 
25-30
stage 26
stage 28
stage 30
Leg
Leg Muscles
Limb Buds
Wing Muscles
 
31-44
stage 44
Limb Buds
 

Entry 5

GEISHA IdTBX2.SzaboRogers.2009Data SourcePublication
Complete cDNA Template Probeshow
GGGTTTGTGGGGTTTTTTTTAATTAATTTTTGTTGTCGATTTCCCTTCCTCTTCCAGTGCGAATTCGCCGGGCAGGAGA
GGGGAGAAAAAAAAAAGATAAAAATAATCAAGCCGAACCGCACACTGATTTTTTATTATTGTTGTTATTATTGTCGTTT
TTTTGTTATTATTATTTTTTTTTTAACAAAAGGGAATCCCTCTTTTTCTCCTGGATTTGTGGATGCACCGATGAGAGAT
CCAGCCTTCCCAGGGACTGCCATGGCTTACCACCCCTTCCACGCTCCCCGGCCGGCCGATTTCCCCATGTCCGCTTTCC
TCGCCGCCGCTCAGCCCTCCTTTTTCCCCGCTCTGGCTCTGCCCCCGGCGGCTCTGGCCAAGCCCATGCCGGACCCGGG
GCTGGCCGGGGCGGCCGAGGCCGGGCTGCACGTCTCGGCTCTGGGCCACCACCACCAGGCAGCCCATCTGCGCTCCCTC
AAGAGCCTGGAGCCCGAGGAGGAGGTGGAGGACGACCCCAAAGTGACGCTGGAAGCCAAAGAGCTTTGGGACCAATTCC
ACAAGCTGGGCACCGAGATGGTGATCACCAAATCCGGGAGGAGGATGTTCCCCCCGTTCAAGGTGCGGGTGAGCGGCCT
GGACAAGAAGGCCAAATACATTTTGCTCATGGATATAGTTGCGGCCGACGACTGCCGGTACAAATTCCACAACTCCCGC
TGGATGGTGGCCGGGAAGGCCGACCCGGAGATGCCCAAACGCATGTACATCCACCCCGACAGCCCGGCCACCGGCGAGC
AGTGGATGGCCAAACCCGTTGCCTTTCACAAACTCAAGCTCACCAACAACATCTCGGACAAACACGGCTTTACCATCCT
GAACTCCATGCACAAATACCAGCCCCGCTTCCACATCGTGCGGGCCAACGACATCCTCAAGCTGCCCTACAGCACCTTC
CGCACCTACGTGTTCCCCGAGACCGACTTCATCGCCGTCACCGCCTACCAGAACGACAAGATCACGCAGCTGAAAATCG
ATAACAACCCCTTCGCCAAAGGCTTTCGGGACACGGGCAACGGCCGTCGGGAGAAGAGGAAGCAGCTCTCGCTGCCGTC
ACTGCGGATGTACGAGGAGCCCTGCAAACCCGATCGAGACGGCGGCGAATCGGACGCGTCTTCCTGCGAACCATCGGCG
GTGCGCGACGCTCTGCACTCCCCCGTGGGCCCCCTCCCCAGCCCCCTGCGCCTGAAGGGCAGTGGCAGAGAGGAGAAGC
CGGGGGCTGACAGTGATGCGGAGGTGGAGAAGGTGTCCGAGGAGCGGCCAGTGGGCGGCAGCCCCGGTAGGGAGGACAC
ATCACCCCGTGGCAGCCCACGGTGCACCGACGAGCGGGGCAAGGAGAGGCACAGCCCGGAGAAAGCCAAGGATGGAGCA
TCCCCAGGGGACGGCCCCAGTGAGGGTCTGTTTGGCGCACGGGGCATGGAGAAGGACAAAGTGGAAGGGAGGAGGAAAG
AGCCGGAGCAGGGCAAGAAGGACGCAGAGGGGGTCGGGCTGGGCAAGGAGGCCTTTGCCCCGCTGATGGTGCACACGGA
CAGCCCTCCGCACCTGAGCGCCGGGCACCTGCAGAGCCTCGCGCTCTCTGGGCTCCACGGGCAGCAGTTCTTCAGCCCG
CTGGGTGCTGGGCAGCCACTCTTCATCCACCCGGGACAGTTCGCCATGGCCCCCGGGGCTTTCTCCGCTATGGGCATGG
GACATTTGCTGGCCTCGGTGACCGGCGGCGGCAGCCTGGAGAACGGGGCACTCTCGTCCACCCCAGGCGCAGCGGGGAC
AGCCACCCCCTTCCCATTCCACCTCTCCCAGCACATGCTGGCTTCTCAGGGAATCCCGATGCCCACTTTCGGCGGCCTC
TTCCCCTACCCCTACACCTACATGGCAGCAGCAGCAGCAGCCGCCTCGGCCATGCCGGCCACCAGCGCAGCCGCCGCCG
CCGCCGGGCCGCTGTCCCGCAATCCCTTCCTGGGCAGCAGCCGCCCCCGCCTGCGCTTCAGCCCCTACCAGCTCCCGGT
CAGCATCCCACCCAGCACCAACCTGCTCACCACCGGCCTCCCCTCCAGCCTCAACCCCAGCTCCGAGGGCTCCAAGGCG
GGCAGCAGCCGTGAGCCCAGCCCCATCCCCGACGTGCACAAAGCCCATCGCCCCTCTGCCTCCCCTCCCAAAGGTTCCC
TGAAGGAATCCCTCAACGAACTGCAGAACATCCAGAGACTGGTGAGCGGGCTGGAGAGCCAGCGGGAGCTGTCGCCCGG
CAGGGAGTCCCCCAAGTGA
CitationSzabo-Rogers HL, Geetha-Loganathan P, Whiting CJ, Nimmagadda S, Fu K, Richman JM. Novel skeletogenic patterning roles for the olfactory pit. Development. 2009 Jan;136(2):219-29. Epub 2008 Dec 4.
CopyrightPublished by The Company of Biologists 2009. This material is protected by a copyright retained by the authors. Permission requested from Dr. Richman.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # XM_001235320.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
stage 15
stage 15
stage 15
stage 15
Ear/Otic Placode
Eye
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
 

Entry 6

GEISHA IdTBX3.Fisher.2008Data SourcePublication
Complete cDNA Template Probeshow
ATGAATATACCGATGAGAGATCCAGTGATCCCTGGGACAAGCATGGCTTATCATCCTTTTTTACCTCACCGGGCACCGG
ACTTTGCCATGAGTGCCGTGCTGGGACATCAGCCCCCCTTCTTCCCGGCCCTGGCTTTGCCCCCCAATGGGGCGGCCGC
CCTCTCCCTCCCCGGCGCCCTGGCTAAGCCCATTATGGATCAGCTAGTGGGGGCTGCAGAGACTGCTATCCCCTTTTCT
TCCCTGGGCCACCAGGCAGCAGCCCATCTGAGGCCTTTAAAAACTCTGGAGCCAGAGGAAGAAGTGGAAGACGACCCGA
AAGTGCACCTGGAAGCCAAAGAGCTTTGGGAACAATTCCATAAAAGAGGCACGGAGATGGTGATCACCAAATCGGGAAG
GAGAATGTTTCCTCCGTTTAAAGTGAGATGCACTGGACTGGATAAAAAGGCCAAGTACATTTTATTGATGGATATTGTG
GCGGCTGACGACTGTAGGTACAAATTCCATAATTCCCGGTGGATGGTAGCCGGCAAAGCTGACCCTGAAATGCCAAAGA
GAATGTACATCCACCCGGACAGCCCGGCCACCGGAGAACAATGGATGTCCAAAGTCGTCACCTTTCACAAGCTGAAGCT
CACTAACAACATCTCCGACAAGCACGGATTTGTGAGTCCTTTTCCTTCCCCCCACCCCGCCCTCCCCGGCCGCTCCGCA
CCGCAGACCATTTTAAACTCCATGCACAAGTACCAGCCCCGCTTCCACATCGTCCGAGCGAACGATATTCTCAAGCTTC
CCTACAGCACGTTCCGGACCTACGTGTTCCCGGAGACTGAATTCATCGCAGTGACCGCATACCAGAATGATAAGATCAC
TCAATTAAAAATTGACAACAACCCCTTTGCCAAAGGTTTTCGCGACACTGGGAATGGAAGGAGGGAAAAAAGGAAGCAG
CTGACCCTGCAATCCATGCGGGTGTACGACGAGAGGCAGAAGAAAGAAAACCCCACTTCGGACGAATCGTCCAACGAGC
AGACAGCCTTCAAGTGCTTCGCGCAGTCCTCCTGCCCCGCCGTGCCCGCCGTCGGCACCTCCAGCCTCAAAGATCTCTG
TCCCAGCGAGGGTGACAGCGATGCCGACAGCAAAGACGACCCTTTGCTAGAAGCCAGCGAGTCGGGCAAAATCAGCACG
ACCACGGCCACCACCCCCGCGCCAGCCAGCTCCGGGGCGGCCGCGAGTGACGACCCTCGGGACAAAGGGGGCAGCCCTT
CCAAAAGCCACTTCTTCCCCAGCGACTCGGCGACGAGCCGGAGCCGGGAGAGGACGGAAAAGGCCCCCCCGGACTCCAG
GCACAGCCCGGCCACCATCTCCTCCAGCAGCCGGGGGGGAGGCTTGAGCGGCGAGGAACTGAAAAGCCCCCTCCGGGAC
GGCCCTAAAGTAGACGAGAACCGGCTGCTGGGCAAAGAGCCCTTCGCCCCCCTCACGGTCCAGACCGACAGCACGGCGC
ACCTGAGCCAGGGACATTTGCAGAACCTGGGGTTCCCCCCCGCCCTGGCCGGCCAGCAGTTCTTCAACCCGCTGGGGAG
CGGGCATCCGCTGCTGCTGCACCCCGGGCAGTTCGCTATGGGGGGGGCTTTCTCCGGCATGGCCGCGGGCATGGGTCCG
CTGCTCGCCACGGTGTCGGGGGCTTCCGCCGGCGGCTCGGGACTGGACAGCACGGTGATGGCCACGGCGGCGGCCCAGG
GACTCTCGGGGGCATCCACAGCCGCTCTGCCCTTCCACCTGCAGCAGCACGTCCTGGCCTCTCAGGGCTTGGCCATGTC
CCCCTTCGGCAGCCTCTTCCCCTACCCCTACACCTACATGGCGGCGGCGGCGGCGGCTTCCAGCGCGGCCTCCAATTCT
GTGCACCGGCATCCCTTCCTCAACGCCGTGCGGCCCCGGCTCCGCTACAGCCCCTACCCGTTGCCCGTGCCCCTGCCCG
ACGGCAGCAGCCTCCTCACCACCGCAATGCCCGGGGCCCTGGCCGCGACCTCCGGAGAGACCAAAGGCAGCGCTCTGGC
CTCCAGTCCCGGCGCCGTGCCCCTGGACTCCGCCTCGGACCTCACCAGTCGCTCGTCCACGCTCTCCTCCGGCTCCGTA
TCCCTGTCCCCAAAGCTGGGAGCCGACAAGGAGGCGGCCACCAGCGAACTGCAGAACATCCAGCGCCTGGTCAGCGGCC
TCGACCCCAAGCAGGACAGATCTCGCAGTGGCTCCCCGTAG
CitationFisher ME, Clelland AK, Bain A, Baldock RA, Murphy P, Downie H, Tickle C, Davidson DR, Buckland RA. Integrating technologies for comparing 3D gene expression domains in the developing chick limb. Dev Biol. 2008 May 1;317(1):13-23. Epub 2008 Feb 7.
CopyrightCopyright © 2008 Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #XM_001234534.2 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
Ear/Otic Placode
Limb Buds
Pharyngeal Arches and Clefts
Pineal Gland
Trunk Mesenchyme
double labeled

Entry 7

GEISHA IdTbx3.Gibson-Brown.1998Data SourcePublication
Complete cDNA Template Probeshow
ATGAATATACCGATGAGAGATCCAGTGATCCCTGGGACAAGCATGGCTTATCATCCTTTTTTACCTCACCGGGCACCGG
ACTTTGCCATGAGTGCCGTGCTGGGACATCAGCCCCCCTTCTTCCCGGCCCTGGCTTTGCCCCCCAATGGGGCGGCCGC
CCTCTCCCTCCCCGGCGCCCTGGCTAAGCCCATTATGGATCAGCTAGTGGGGGCTGCAGAGACTGCTATCCCCTTTTCT
TCCCTGGGCCACCAGGCAGCAGCCCATCTGAGGCCTTTAAAAACTCTGGAGCCAGAGGAAGAAGTGGAAGACGACCCGA
AAGTGCACCTGGAAGCCAAAGAGCTTTGGGAACAATTCCATAAAAGAGGCACGGAGATGGTGATCACCAAATCGGGAAG
GAGAATGTTTCCTCCGTTTAAAGTGAGATGCACTGGACTGGATAAAAAGGCCAAGTACATTTTATTGATGGATATTGTG
GCGGCTGACGACTGTAGGTACAAATTCCATAATTCCCGGTGGATGGTAGCCGGCAAAGCTGACCCTGAAATGCCAAAGA
GAATGTACATCCACCCGGACAGCCCGGCCACCGGAGAACAATGGATGTCCAAAGTCGTCACCTTTCACAAGCTGAAGCT
CACTAACAACATCTCCGACAAGCACGGATTTACCATTTTAAACTCCATGCACAAGTACCAGCCCCGCTTCCACATCGTC
CGAGCGAACGATATTCTCAAGCTTCCCTACAGCACGTTCCGGACCTACGTGTTCCCGGAGACTGAATTCATCGCAGTGA
CCGCATACCAGAATGATAAGATCACTCAATTAAAAATTGACAACAACCCCTTTGCCAAAGGTTTTCGCGACACTGGGAA
TGGAAGGAGGGAAAAAAGGAAGCAGCTGACCCTGCAATCCATGCGGGTGTACGACGAGAGGCAGAAGAAAGAAAACCCC
ACTTCGGACGAATCGTCCAACGAGCAGACAGCCTTCAAGTGCTTCGCGCAGTCCTCCTGCCCCGCCGTGCCCGCCGTCG
GCACCTCCAGCCTCAAAGATCTCTGTCCCAGCGAGGGTGACAGCGATGCCGACAGCAAAGACGACCCTTTGCTAGAAGC
CAGCGAGTCGGGCAAAATCAGCACGACCACGGCCACCACCCCCGCGCCAGCCAGCTCCGGGGCGGCCGCGAGTGACGAC
CCTCGGGACAAAGGGGGCAGCCCTTCCAAAAGCCACTTCTTCCCCAGCGACTCGGCGACGAGCCGGAGCCGGGAGAGGA
CGGAAAAGGCCCCCCCGGACTCCAGGCACAGCCCGGCCACCATCTCCTCCAGCAGCCGGGGGGGAGGCTTGAGCGGCGA
GGAACTGAAAAGCCCCCTCCGGGACGGCCCTAAAGTAGACGAGAACCGGCTGCTGGGCAAAGAGCCCTTCGCCCCCCTC
ACGGTCCAGACCGACAGCACGGCGCACCTGAGCCAGGGACATTTGCAGAACCTGGGGTTCCCCCCCGCCCTGGCCGGCC
AGCAGTTCTTCAACCCGCTGGGGAGCGGGCATCCGCTGCTGCTGCACCCCGGGCAGTTCGCTATGGGGGGGGCTTTCTC
CGGCATGGCCGCGGGCATGGGTCCGCTGCTCGCCACGGTGTCGGGGGCTTCCGCCGGCGGCTCGGGACTGGACAGCACG
GTGATGGCCACGGCGGCGGCCCAGGGACTCTCGGGGGCATCCACAGCCGCTCTGCCCTTCCACCTGCAGCAGCACGTCC
TGGCCTCTCAGGGCTTGGCCATGTCCCCCTTCGGCAGCCTCTTCCCCTACCCCTACACCTACATGGCGGCGGCGGCGGC
GGCTTCCAGCGCGGCCTCCAATTCTGTGCACCGGCATCCCTTCCTCAACGCCGTGCGGCCCCGGCTCCGCTACAGCCCC
TACCCGTTGCCCGTGCCCCTGCCCGACGGCAGCAGCCTCCTCACCACCGCAATGCCCGGGGCCCTGGCCGCGACCTCCG
GAGAGACCAAAGGCAGCGCTCTGGCCTCCAGTCCCGGCGCCGTGCCCCTGGACTCCGCCTCGGACCTCACCAGTCGCTC
GTCCACGCTCTCCTCCGGCTCCGTATCCCTGTCCCCAAAGCTGGGAGCCGACAAGGAGGCGGCCACCAGCGAACTGCAG
AACATCCAGCGCCTGGTCAGCGGCCTCGACCCCAAGCAGGACAGATCTCGCAGTGGCTCCCCGTAG
CitationGibson-Brown JJ, I Agulnik S, Silver LM, Papaioannou VE. Expression of T-box genes Tbx2-Tbx5 during chick organogenesis. Mech Dev. 1998 Jun;74(1-2):165-9.
CopyrightCopyright © 1998 Elsevier Science Ireland Ltd.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001270878).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 15
Ear/Otic Placode
Eye
Leg
Somites
Wing
 
19-24
stage 21
stage 21
stage 21
Allantois
Dermomyotome
Lateral Plate Mesoderm
Leg
Neural Plate/Tube
Pharyngeal Arches and Clefts
Wing
maxilla
sp, somatopleure
31-44
stage 44
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.27708

Mouse

EmageMGI:98495
EurexpressMGI:98495
MGI GXDMGI:98495

Frog

Xenbase1018230

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070209-80, ZDB-GENE-060531-144
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona