GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TCF7L2
transcription factor 7-like 2 (T-cell specific, HMG-box)

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolTCF7L2
Official Full Nametranscription factor 7-like 2 (T-cell specific, HMG-box)
CGNC ID49355
also known asTCF4, transcription factor 7-like 2|transcription factor Tcf4, Tcf4 , TCF7L2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001206510
PolypeptideNP_001193439
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.31562
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly43769FBgn0085432
Human6934ENSG00000148737MIM:125853MIM:602228
Mouse21416ENSMUSG00000024985All phenotypic alleles (5):Targeted, knock-out(1) Targeted, other(4) MGI:1202879
Xenopus100101719, 399164485974
Zebrafish30510ENSDARG00000004415ZDB-GENE-991110-8ZFIN:ZDB-GENE-991110-8
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395508
Ensembl GeneENSGALG00000008883
KEGGgga:395508

Entry 1

GEISHA IdTcf4.Bonafede.2006Data SourcePublication
Complete cDNA Template Probeshow
CCGGCTCCACTGTACAGTCAGACAAGTTTCTCTAAGCACAGATTTCTAGTGCGAAGAACAAACAGGGCAGCAACTGTTC
TTGTTGAAAGAAGGCACATTTTAAAACGGTGTAACGCTTTCCATACAAAGCTGAGTGTGCTCCAGAGAACCTTTACAAC
TCTGTAGTCGTAGAAGGTCTCTGGTAGTCAGTCATCAGTTCTTTCTCTCCTTTTTTTTTGGTTCTAATTTTTAGTACTT
TATCCTAATATAAACACAGTATAATTTCAGTAATGCTAAACATAAACACATCACCTGATCACTGCAGCTTTTGATAAGT
TCAGCACATGCCAGCCCACCTATGCTCTTCCACAAAAATATTCCCTTTCACCACCTGTTAATCACTAACAAGGATAATT
AAGGCCCTATCTTAGTGGGCAGTGAAGTTCAGTGAAAACCAAACCAAACCCATTATTAATAGACATTTCTGGAACCACA
ATGACGGAGTAGTTTGGGTTGGAAGGGACCTTAAAGCCCACTCAACCCCAACCCCTGCCATAAGCAGGCCTGCCTCCTA
CCAGCTTAGGCTGCCCAGGGCCCCATGCATCCCAGTCTTGTAACACCTCCACGGATGGGGCACCAAAGCTCTCTGGGCA
GCAGTGCCAGCACAACACCCACATAACAAAAGATTTATTCCTTGTTTCTAATCTAAAATCTACCCTCTTTCAGCTAAAA
ACCCTTACTCATTGTCCTAACACTACGCTCACTGGCATGTCTCTTCCCAGCTTTACTCCCTTTCAGTATTGGAAGGCCT
CAATGAGGACAGCAGCGCCCAAGATGGGGACAGAGGGCGTGGTGTGGCAGTTCAGGCAGGAACGGCAGCCACAGCCCAG
CAGGCAGCCCGCTCCTTTCTCTTCTGAGAGCAGCGGGGAGCTGCACTCTGTTGAAACAAACATGGTGACCACCTGCCAC
AGTGGTTGAACTCAGGTACAAACACAGGCTGGGGGGCCACAACTACTCTGGGCTGATGCATGCACCCAGACAGAGCTCC
CAAGGAGAGACAGAGCTGCCCAGATCTCCAGTTGTGGCAAACTCCAGAATCTGGGAGTCTTTCTAGGGCCTGAGTGCAG
ATGTCACGGCTGCAAGTGTGCCTAGCTTGATGAGATTTCTGAGCAGGTGGCCAGGTTGTGTGAGGAAATCACCAGGCAG
CACAGTTTCTGTGAATCAGAGACTTATGTGTGGTACTGTTCAGTGACAGACAGACAACCCTGTCTTAAGTCCCTGCAAG
AGGAAGGTAAGCTAGATTCCAACTCTGAGGAGACAGCAAAAACATGCAAGTGGAAGGAAATGGAACCCCCCCATCCGCT
AGGATGGTTAGTACCACAGCAAGGTCAGCCAGTGTACCCAATCACGACAGGGGGTTTCCGCCACCCTTACCCAACAGCT
CTGACTGTCAATGCTTCCATGTCAAGCTTTCTCTCCTCTAGGTTTCCTCCACACATGGTCCCGCCACACCATAGTTTAC
ATACAACTGGAATCCCTCATCCGGCCATAGTCACACCAACAGTCAAACAAGAATCTTCCCAGAGTGACGTCGGCTCACT
CCACAGCTCAAAACATCAGGACTCCAAAAAAGAAGAAGAGAAAAAGAAGCCACACATAAAGAAACCTCTTAATGCATTT
ATGTTGTATATGAAGGAAATGAGAGCAAAAGTTGTAGCAGAATGCACATTGAAAGAGAGTGCAGCCATCAACCAAATCC
TCGGTCGAAGGTGGCATGCGTTATCCAGAGAAGAACAAGCGAAATACTATGAACTGGCAAGAAAGGAACGACAGCTTCA
TATGCAGCTGTACCCGGGCTGGTCTGCACGGGATAACTATGGAAAGAAGAAGAAGAGGAAAAGGGATAAGCAGCCAGGA
GAGACCAATGACCTGAGCGCTCCTAAGAAATGCCGAGCGCGCTTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCCT
GCAGGAGAAAAAAAAAGTGCGTTCGCTACATACAAGGTGAAGGCAGCTGCGTCAGCCCACCCTCTTCAGATGGAAGCTT
ACTAGACTCTCCTCCGTCCTCCCCCGCCATGCTCGCCTCCCCCTCCAGAGACTCAAAACCACAGACTGAACAAACGCAA
CCCCTCTCGCTCTCCCTGAAGCCCGACCCGCTGGCGCACCTGGTCATGATGCCGCCGCCATCCTCGCTCGTCCTCGCCG
AGAGCGCTGCGAGCAAGCCCGGCGCCCTGCCTGCCGCCAGCTGCCCCAACGGGCCCTGGGACCACGCGCCGGCCGCCCT
CCCGCCGGCCGCATCCCTCGCACAGCCCTCCACCTCCTCCCTACATTCCCACAG
CitationBonafede A, Köhler T, Rodriguez-Niedenführ M, Brand-Saberi B. BMPs restrict the position of premuscle masses in the limb buds by influencing Tcf4 expression. Dev Biol. 2006 Nov 15;299(2):330-44. Epub 2006 Jun 15.
CopyrightCopyright © 2006 Elsevier B.V. All rights reserved.
CommentsThe following probes were used: Sf/Hgf (Thery et al., 1995), qPax3, MyoD and Myf5, Lbx1, Bmp2 and Bmp4, Tcf4. Probes used in this study were kindly provided by Claudio Stern, Gabrielle Kardon, Christophe Marcelle, Bruce M. Paterson, Susanne Dietrich and Paul Brickell. Thus insufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25
stage 25
stage 25
stage 25
stage 25
Wing Muscles
pre-muscle

Entry 2

GEISHA IdTCF4.Theodosiou.2003Data SourcePublication
Complete cDNA Template Probeshow
CCAGGAGGAAAATGCCGCAGCTGAACGGCGGTGGAGGGGACGACCTGGGCGCCAACGATGAACTGATCTCTTTCAAAGA
CGAAGGGGAGCAGGAGGAGAAGATCTCCGAGAACTCCTCGGCCGAGAGGGATTTAGCTGATGTCAAATCGTCTCTCGTC
AATGAATCAGAAACGAATCAAAACAGCTCCTCGGACTCGGAGGCGGAGCGGCGGCCCCCGCCTCGCTCCGAAACTTTCA
GAGATAAATCCCGGGAAAGTTTGGAGGAAGCTGCGAAGAGGCAAGATGGAGGGTTGTTTAAGGGCCCACCATACCCGGG
TTATCCCTTTATAATGATCCCCGACCTCAGCAGCCCGTATCTGCCCAACGGATCGCTCTCTCCGACGGCGAGGACGTAT
CTGCAGATGAAATGGCCACTGCTTGATGTTCAGGCAGGGAGCCTTCAGAGTAGACAAGCCCTCAAGGATGCTAGGTCTC
CATCTCCAGCACACATTGTTTCTAACAAAGTGCCAGTTGTGCAGCACCCGCACCATGTACACCCTCTTACGCCGCTTAT
CACATACAGCAATGAGCACTTCACACCAGGAAACCCTCCTCCACACTTACCAGCCGACGTAGATCCAAAAACAGGAATT
CCAAGACCTCCACATCCTCCAGACATATCTCCTTATTATCCCCTATCACCAGGCACTGTAGGACAAATCCCCCATCCGC
TAGGATGGTTAGTACCACAGCAAGGTCAGCCAGTGTACCCAATCACGACAGGGGGTTTCCGCCACCCTTACCCAACAGC
TCTGACTGTCAATGCTTCCATGTCAAGGTTTCCTCCACACATGGTCCCGCCACACCATAGTTTACATACAACTGGAATC
CCTCATCCGGCCATAGTCACACCAACAGTCAAACAAGAATCTTCCCAGAGTGACGTCGGCTCACTCCACAGCTCAAAAC
ATCAGGACTCCAAAAAAGAAGAAGAGAAAAAGAAGCCACACATAAAGAAACCTCTTAATGCATTTATGTTGTATATGAA
GGAAATGAGAGCAAAAGTTGTAGCAGAATGCACATTGAAAGAGAGTGCAGCCATCAACCAAATCCTCGGTCGAAGGTGG
CATGCGTTATCCAGAGAAGAACAAGCGAAATACTATGAACTGGCAAGAAAGGAACGACAGCTTCATATGCAGCTGTACC
CGGGCTGGTCTGCACGGGATAACTATGGAAAGAAGAAGAAGAGGAAAAGGGATAAGCAGCCAGGAGAGACCAATGAACA
CAGCGAATGTTTCCTAAATCCTTGCCTTTCACTTCCTCCGATTACAGACCTGAGCGCTCCTAAGAAATGCCGAGCGCGC
TTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCCTGCAGGAGAAAAAAAAAGTGCGTTCGCTACATACAAGGTGAAG
GCAGCTGCGTCAGCCCACCCTCTTCAGATGGAAGCTTACTAGACTCTCCTCCGTCCTCCCCCGCCATGCTCGCCTCCCC
CTCCAGAGACTCAAAACCACAGACTGAACAAACGCAACCCCTCTCGCTCTCCCTGAAGCCCGACCCGCTGGCGCACCTG
GTCATGATGCCGCCGCCATCCTCGCTCGTCCTCGCCGAGAGCGCTGCGAGCAAGCCCGGCGCCCTGCCTGCCGCCAGCT
GCCCCAACGGGGCCCTGGACCACGCGCCGGCCGCCCTCCCGCCGGCCGCATCCCTCGCACAGCCCTCCACCTCCTCCCT
ACATTCCCACAGCTCGCTGGCGGGGCCGCAGCCCCAGCCGCTCTCCCTCGTAACCAAGTCCTTAGAATAGCTTTAGCCT
CTGTCGCCCTTTCGGTTTCCTTCGGGGTGGTTGGATTCTGTTGGGATTTGGGTTTGGTTTGGTTTTGTTTTTTTCCTTT
TCTTTTTTTTTTTTTCATTTTTCTTCTGTTTTTTTTCTTTTCCTCCTCCTCCTCGTCGTCGTCCACCGTTCGTCGTCGT
TTCTCGGTTTCATTTCCAGTTTGTGCCACATGGCTACATTAGTTGATGTTTTATCGAGTTCATTGGTCAATATTTGACC
CATTCTTATTTCAATTTCTCCTTTTTAAATATGTAGATGAGAAGAGCCTCATGATTCTGCCAAAATTTTTATCAACAGC
TGTTTAAAGTCTTTGTAGCGTTTAAAAAATATATATATATACATAATTGTTATGTAGTTCCAATAGCTTAGTTTTAAAG
ACTGATTTTAAAAATTAAAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAGAAGCAATTTTGAAGCAGCCCTTGCCG
GAGGCATTGGTTCTTTATTATTTGTATTAAATACGAGCTTGCGAACCAATCATTTTACATCTGGTTTTTAAACCTTTAA
GGGCACAGTGAATGCAGTGCCGCTACTACTTCTTTTTTTTTTTTTTCCTTCCTCGTGTGAAACAACCTTTATTGTGATG
TTACTTGTTATTGTTTAAATGTACAGAAACAAAGGGTTAAAAAAAAATGTGTTAATATACCTTGTTCCATGGTGTTGTT
CTTTTTGGGGGAGGGAACGCTACTCAACAATTAAAAGTATCACAACGCTATTGGACCAGTAGTATTTATTGCTTTAGAA
ATTGCTTGTTGTATCTGTATGTTGTCCCTTTTTAAATGGTTTTTTTCCTCTTTTTTTTTTCTTGAAACATTGTATAAAG
TTTTTTGGTTTTTTTTTTTTTTGCCCTTAGTGTAAGCATCTTATATATAACAACTCATTTGTACAAGGTTTTTAAGTTT
ATATATAAATGTGTATATATATATTTTTTCCAGGATTTTTTTTTTTTTGACTTCCTTTCGTGATTTTTTTTTTTTTCTG
TATGAAACACGGTTGCCACCAAACGGACATTTGCAGATGCATTTTTCAAGGATCAATAGTGTAAAAAAAAATAGAAATC
GCTTTAAAAGCCATTACACACACACACACACACACACACGCACGCACACAAAATAAAGAGACTTGAAAACTGAGCAAGG
GAATTTTTCACAACGCTGTTTGAAAAATAGCAAGGTCCAAGTGTGTCCCGTTCAGAACTGCAGCTGGATCCCCTGCGGC
ATCAGGACTGTAGGCTGTGTGCAAAATCTCCATGTGCCAAAATTCTCAGTGACTTTAAACTTTCTCCCGACAACTTTAT
TATTTTATTATTATTATTATTTTTTAATGCTGTAATTTTTTTGTTCATCATGTTTTGCTGTGATGTTACATAGGTAGAT
ATGTATGTAGTTTTAATGTCACCTATAACAGACGTGTTTGGTAGCAGATTGTCCGGAAAGCATTTAAAATGAAGAGGTA
TAAACCCTTAAGGGCCAAATTCTGTATATTAGATTATTCATAAAAGGAAAATCAGACTGCCACTTTTATGTACACTTAC
TACATACAGGTAGGTAGCAAACTTAAAACATAAAAAAAAAAAAAAACCTAGGCATGTTGATGTTGCAAAAAACGCTGTA
TAAAGCTGAAAAATTGTTCATCTGTTCATTCAGTGCCATTGTAGTTGACATGAAGCGATTGTAAAACTGTCTCAAATTT
TTCTCTGGTTTATTAAGATGCTAACTATAACATTTTTTGTGAATACTTTGAATGTTTCCTAACAGTTGTGATGTTACTG
TTCCGTTTTATGCTCTTATTCCGATTTTCATTTTTAATGGTTTGGAAGCCATTTTTTGTAATGAATAAATGTTCATGCT
GTACAGTATCTGTAGCATGCAGTTCTGGATTAATAAAAGCAACTTAGTATGTGCAGAGAA
CitationTheodosiou NA, Tabin CJ. Wnt signaling during development of the gastrointestinal tract. Dev Biol. 2003 Jul 15;259(2):258-71.
CopyrightCopyright © 2003 Elsevier Science (USA). All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc. #XM_421760.2)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
stage 22
stage 24
stage 24
Gizzard
 
31-32
stage 32
stage 32
Foregut
 

Entry 3

GEISHA IdTCF4.Quinlan.2009Data SourcePublication
Complete cDNA Template Probeshow
CCAGGAGGAAAATGCCGCAGCTGAACGGCGGTGGAGGGGACGACCTGGGCGCCAACGATGAACTGATCTCTTTCAAAGA
CGAAGGGGAGCAGGAGGAGAAGATCTCCGAGAACTCCTCGGCCGAGAGGGATTTAGCTGATGTCAAATCGTCTCTCGTC
AATGAATCAGAAACGAATCAAAACAGCTCCTCGGACTCGGAGGCGGAGCGGCGGCCCCCGCCTCGCTCCGAAACTTTCA
GAGATAAATCCCGGGAAAGTTTGGAGGAAGCTGCGAAGAGGCAAGATGGAGGGTTGTTTAAGGGCCCACCATACCCGGG
TTATCCCTTTATAATGATCCCCGACCTCAGCAGCCCGTATCTGCCCAACGGATCGCTCTCTCCGACGGCGAGGACGTAT
CTGCAGATGAAATGGCCACTGCTTGATGTTCAGGCAGGGAGCCTTCAGAGTAGACAAGCCCTCAAGGATGCTAGGTCTC
CATCTCCAGCACACATTGTTTCTAACAAAGTGCCAGTTGTGCAGCACCCGCACCATGTACACCCTCTTACGCCGCTTAT
CACATACAGCAATGAGCACTTCACACCAGGAAACCCTCCTCCACACTTACCAGCCGACGTAGATCCAAAAACAGGAATT
CCAAGACCTCCACATCCTCCAGACATATCTCCTTATTATCCCCTATCACCAGGCACTGTAGGACAAATCCCCCATCCGC
TAGGATGGTTAGTACCACAGCAAGGTCAGCCAGTGTACCCAATCACGACAGGGGGTTTCCGCCACCCTTACCCAACAGC
TCTGACTGTCAATGCTTCCATGTCAAGGTTTCCTCCACACATGGTCCCGCCACACCATAGTTTACATACAACTGGAATC
CCTCATCCGGCCATAGTCACACCAACAGTCAAACAAGAATCTTCCCAGAGTGACGTCGGCTCACTCCACAGCTCAAAAC
ATCAGGACTCCAAAAAAGAAGAAGAGAAAAAGAAGCCACACATAAAGAAACCTCTTAATGCATTTATGTTGTATATGAA
GGAAATGAGAGCAAAAGTTGTAGCAGAATGCACATTGAAAGAGAGTGCAGCCATCAACCAAATCCTCGGTCGAAGGTGG
CATGCGTTATCCAGAGAAGAACAAGCGAAATACTATGAACTGGCAAGAAAGGAACGACAGCTTCATATGCAGCTGTACC
CGGGCTGGTCTGCACGGGATAACTATGGAAAGAAGAAGAAGAGGAAAAGGGATAAGCAGCCAGGAGAGACCAATGAACA
CAGCGAATGTTTCCTAAATCCTTGCCTTTCACTTCCTCCGATTACAGACCTGAGCGCTCCTAAGAAATGCCGAGCGCGC
TTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCCTGCAGGAGAAAAAAAAAGTGCGTTCGCTACATACAAGGTGAAG
GCAGCTGCGTCAGCCCACCCTCTTCAGATGGAAGCTTACTAGACTCTCCTCCGTCCTCCCCCGCCATGCTCGCCTCCCC
CTCCAGAGACTCAAAACCACAGACTGAACAAACGCAACCCCTCTCGCTCTCCCTGAAGCCCGACCCGCTGGCGCACCTG
GTCATGATGCCGCCGCCATCCTCGCTCGTCCTCGCCGAGAGCGCTGCGAGCAAGCCCGGCGCCCTGCCTGCCGCCAGCT
GCCCCAACGGGGCCCTGGACCACGCGCCGGCCGCCCTCCCGCCGGCCGCATCCCTCGCACAGCCCTCCACCTCCTCCCT
ACATTCCCACAGCTCGCTGGCGGGGCCGCAGCCCCAGCCGCTCTCCCTCGTAACCAAGTCCTTAGAATAGCTTTAGCCT
CTGTCGCCCTTTCGGTTTCCTTCGGGGTGGTTGGATTCTGTTGGGATTTGGGTTTGGTTTGGTTTTGTTTTTTTCCTTT
TCTTTTTTTTTTTTTCATTTTTCTTCTGTTTTTTTTCTTTTCCTCCTCCTCCTCGTCGTCGTCCACCGTTCGTCGTCGT
TTCTCGGTTTCATTTCCAGTTTGTGCCACATGGCTACATTAGTTGATGTTTTATCGAGTTCATTGGTCAATATTTGACC
CATTCTTATTTCAATTTCTCCTTTTTAAATATGTAGATGAGAAGAGCCTCATGATTCTGCCAAAATTTTTATCAACAGC
TGTTTAAAGTCTTTGTAGCGTTTAAAAAATATATATATATACATAATTGTTATGTAGTTCCAATAGCTTAGTTTTAAAG
ACTGATTTTAAAAATTAAAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAGAAGCAATTTTGAAGCAGCCCTTGCCG
GAGGCATTGGTTCTTTATTATTTGTATTAAATACGAGCTTGCGAACCAATCATTTTACATCTGGTTTTTAAACCTTTAA
GGGCACAGTGAATGCAGTGCCGCTACTACTTCTTTTTTTTTTTTTTCCTTCCTCGTGTGAAACAACCTTTATTGTGATG
TTACTTGTTATTGTTTAAATGTACAGAAACAAAGGGTTAAAAAAAAATGTGTTAATATACCTTGTTCCATGGTGTTGTT
CTTTTTGGGGGAGGGAACGCTACTCAACAATTAAAAGTATCACAACGCTATTGGACCAGTAGTATTTATTGCTTTAGAA
ATTGCTTGTTGTATCTGTATGTTGTCCCTTTTTAAATGGTTTTTTTCCTCTTTTTTTTTTCTTGAAACATTGTATAAAG
TTTTTTGGTTTTTTTTTTTTTTGCCCTTAGTGTAAGCATCTTATATATAACAACTCATTTGTACAAGGTTTTTAAGTTT
ATATATAAATGTGTATATATATATTTTTTCCAGGATTTTTTTTTTTTTGACTTCCTTTCGTGATTTTTTTTTTTTTCTG
TATGAAACACGGTTGCCACCAAACGGACATTTGCAGATGCATTTTTCAAGGATCAATAGTGTAAAAAAAAATAGAAATC
GCTTTAAAAGCCATTACACACACACACACACACACACACGCACGCACACAAAATAAAGAGACTTGAAAACTGAGCAAGG
GAATTTTTCACAACGCTGTTTGAAAAATAGCAAGGTCCAAGTGTGTCCCGTTCAGAACTGCAGCTGGATCCCCTGCGGC
ATCAGGACTGTAGGCTGTGTGCAAAATCTCCATGTGCCAAAATTCTCAGTGACTTTAAACTTTCTCCCGACAACTTTAT
TATTTTATTATTATTATTATTTTTTAATGCTGTAATTTTTTTGTTCATCATGTTTTGCTGTGATGTTACATAGGTAGAT
ATGTATGTAGTTTTAATGTCACCTATAACAGACGTGTTTGGTAGCAGATTGTCCGGAAAGCATTTAAAATGAAGAGGTA
TAAACCCTTAAGGGCCAAATTCTGTATATTAGATTATTCATAAAAGGAAAATCAGACTGCCACTTTTATGTACACTTAC
TACATACAGGTAGGTAGCAAACTTAAAACATAAAAAAAAAAAAAAACCTAGGCATGTTGATGTTGCAAAAAACGCTGTA
TAAAGCTGAAAAATTGTTCATCTGTTCATTCAGTGCCATTGTAGTTGACATGAAGCGATTGTAAAACTGTCTCAAATTT
TTCTCTGGTTTATTAAGATGCTAACTATAACATTTTTTGTGAATACTTTGAATGTTTCCTAACAGTTGTGATGTTACTG
TTCCGTTTTATGCTCTTATTCCGATTTTCATTTTTAATGGTTTGGAAGCCATTTTTTGTAATGAATAAATGTTCATGCT
GTACAGTATCTGTAGCATGCAGTTCTGGATTAATAAAAGCAACTTAGTATGTGCAGAGAA
CitationQuinlan R, Graf M, Mason I, Lumsden A, Kiecker C. Complex and dynamic patterns of Wnt pathway gene expression in the developing chick forebrain. Neural Dev. 2009 Sep 4;4:35.
CopyrightCopyright © 2009 Quinlan et al; licensee BioMed Central Ltd. [This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.]
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc# XM_421760.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 13
stage 14
stage 16
stage 16
Diencephalon
Forebrain
Telencephalon
double labeled with Wnt4 (purple)
19
stage 19
stage 19
stage 19
stage 19
stage 19
stage 19
Central Nervous System
Diencephalon
Ectoderm
Forebrain
Midbrain
Telencephalon
double labeled with Wnt4 (purple)

Entry 4

GEISHA IdTCF7L2.Merchan.2011Data SourcePublication
Complete cDNA Template Probeshow
CACCCGCACCATGTACACCCTCTTACGCCGCTTATCACATACAGCAATGAGCACTTCACACCAGGAAACCCTCCTCCAC
ACTTACCAGCCGACGTAGATCCAAAAACAGGAATTCCAAGACCTCCACATCCTCCAGACATATCTCCTTATTATCCCCT
ATCACCAGGCACTGTAGGACAAATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCAGTGTACCCAATC
ACGACAGGGGGTTTCCGCCACCCTTACCCAACAGCTCTGACTGTCAATGCTTCCATGTCAAGGTTTCCTCCACACATGG
TCCCGCCACACCATAGTTTACATACAACTGGAATCCCTCATCCGGCCATAGTCACACCAACAGTCAAACAAGAATCTTC
CCAGAGTGACGTCGGCTCACTCCACAGCTCAAAACATCAGGACTCCAAAAAAGAAGAAGAGAAAAAGAAGCCACACATA
AAGAAACCTCTTAATGCATTTATGTTGTATATGAAGGAAATGAGAGCAAAAGTTGTAGCAGAATGCACATTGAAAGAGA
GTGCAGCCATCAACCAAATCCTCGGTCGAAGGTGGCATGCGTTATCCAGAGAAGAACAAGCGAAATACTATGAACTGGC
AAGAAAGGAACGACAGCTTCATATGCAGCTGTACCCGGGCTGGTCTGCACGGGATAACTATGGAAAGAAGAAGAAGAGG
AAAAGGGATAAGCAGCCAGGAGAGACCAATGAACACAGCGAATGTTTCCTAAATCCTTGCCTTTCACTTCCTCCGATTA
CAGACCTGAGCGCTCCTAAGAAATGCCGAGCGCGCTTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCCTGCAGGAG
AAAAAAAAAGTGCGTTCGCTACATACAAGGTGAAGG
CitationMerchán,P, Bardet, SM, Puelles, L, Ferran, JL, Comparison of Pretectal Genoarchitectonic Pattern between Quail and Chicken Embryos. Front Neuroanat. 2011; 5: 23. Prepublished online 2010 December 29. Published online 2011 April 5
CopyrightCopyright © 2011 Merchán, Bardet, Puelles and Ferran.
CommentsQTcf7l2F: 5′-CACCCGCACCATGTACACCC-3′. QTcf7l2R: 5′-CCTTCACCTTGTATGTAGCG-3′.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-26
stage 26
stage 26
Midbrain
Double labeled

Entry 5

GEISHA IdTCF4.Ferran.2007Data SourcePublication
Complete cDNA Template Probeshow
CCGGCTCCACTGTACAGTCAGACAAGTTTCTCTAAGCACAGATTTCTAGTGCGAAGAACAAACAGGGCAGCAACTGTTC
TTGTTGAAAGAAGGCACATTTTAAAACGGTGTAACGCTTTCCATACAAAGCTGAGTGTGCTCCAGAGAACCTTTACAAC
TCTGTAGTCGTAGAAGGTCTCTGGTAGTCAGTCATCAGTTCTTTCTCTCCTTTTTTTTTGGTTCTAATTTTTAGTACTT
TATCCTAATATAAACACAGTATAATTTCAGTAATGCTAAACATAAACACATCACCTGATCACTGCAGCTTTTGATAAGT
TCAGCACATGCCAGCCCACCTATGCTCTTCCACAAAAATATTCCCTTTCACCACCTGTTAATCACTAACAAGGATAATT
AAGGCCCTATCTTAGTGGGCAGTGAAGTTCAGTGAAAACCAAACCAAACCCATTATTAATAGACATTTCTGGAACCACA
ATGACGGAGTAGTTTGGGTTGGAAGGGACCTTAAAGCCCACTCAACCCCAACCCCTGCCATAAGCAGGCCTGCCTCCTA
CCAGCTTAGGCTGCCCAGGGCCCCATGCATCCCAGTCTTGTAACACCTCCACGGATGGGGCACCAAAGCTCTCTGGGCA
GCAGTGCCAGCACAACACCCACATAACAAAAGATTTATTCCTTGTTTCTAATCTAAAATCTACCCTCTTTCAGCTAAAA
ACCCTTACTCATTGTCCTAACACTACGCTCACTGGCATGTCTCTTCCCAGCTTTACTCCCTTTCAGTATTGGAAGGCCT
CAATGAGGACAGCAGCGCCCAAGATGGGGACAGAGGGCGTGGTGTGGCAGTTCAGGCAGGAACGGCAGCCACAGCCCAG
CAGGCAGCCCGCTCCTTTCTCTTCTGAGAGCAGCGGGGAGCTGCACTCTGTTGAAACAAACATGGTGACCACCTGCCAC
AGTGGTTGAACTCAGGTACAAACACAGGCTGGGGGGCCACAACTACTCTGGGCTGATGCATGCACCCAGACAGAGCTCC
CAAGGAGAGACAGAGCTGCCCAGATCTCCAGTTGTGGCAAACTCCAGAATCTGGGAGTCTTTCTAGGGCCTGAGTGCAG
ATGTCACGGCTGCAAGTGTGCCTAGCTTGATGAGATTTCTGAGCAGGTGGCCAGGTTGTGTGAGGAAATCACCAGGCAG
CACAGTTTCTGTGAATCAGAGACTTATGTGTGGTACTGTTCAGTGACAGACAGACAACCCTGTCTTAAGTCCCTGCAAG
AGGAAGGTAAGCTAGATTCCAACTCTGAGGAGACAGCAAAAACATGCAAGTGGAAGGAAATGGAACCCCCCCATCCGCT
AGGATGGTTAGTACCACAGCAAGGTCAGCCAGTGTACCCAATCACGACAGGGGGTTTCCGCCACCCTTACCCAACAGCT
CTGACTGTCAATGCTTCCATGTCAAGCTTTCTCTCCTCTAGGTTTCCTCCACACATGGTCCCGCCACACCATAGTTTAC
ATACAACTGGAATCCCTCATCCGGCCATAGTCACACCAACAGTCAAACAAGAATCTTCCCAGAGTGACGTCGGCTCACT
CCACAGCTCAAAACATCAGGACTCCAAAAAAGAAGAAGAGAAAAAGAAGCCACACATAAAGAAACCTCTTAATGCATTT
ATGTTGTATATGAAGGAAATGAGAGCAAAAGTTGTAGCAGAATGCACATTGAAAGAGAGTGCAGCCATCAACCAAATCC
TCGGTCGAAGGTGGCATGCGTTATCCAGAGAAGAACAAGCGAAATACTATGAACTGGCAAGAAAGGAACGACAGCTTCA
TATGCAGCTGTACCCGGGCTGGTCTGCACGGGATAACTATGGAAAGAAGAAGAAGAGGAAAAGGGATAAGCAGCCAGGA
GAGACCAATGACCTGAGCGCTCCTAAGAAATGCCGAGCGCGCTTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCCT
GCAGGAGAAAAAAAAAGTGCGTTCGCTACATACAAGGTGAAGGCAGCTGCGTCAGCCCACCCTCTTCAGATGGAAGCTT
ACTAGACTCTCCTCCGTCCTCCCCCGCCATGCTCGCCTCCCCCTCCAGAGACTCAAAACCACAGACTGAACAAACGCAA
CCCCTCTCGCTCTCCCTGAAGCCCGACCCGCTGGCGCACCTGGTCATGATGCCGCCGCCATCCTCGCTCGTCCTCGCCG
AGAGCGCTGCGAGCAAGCCCGGCGCCCTGCCTGCCGCCAGCTGCCCCAACGGGCCCTGGGACCACGCGCCGGCCGCCCT
CCCGCCGGCCGCATCCCTCGCACAGCCCTCCACCTCCTCCCTACATTCCCACAG
CitationFerran JL, Sánchez-Arrones L, Sandoval JE, Puelles L. A model of early molecular regionalization in the chicken embryonic pretectum. J Comp Neurol. 2007 Dec 1;505(4):379-403.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
stage 17
stage 17
Diencephalon
Isthmus/MHB
 
19-24
stage 24
stage 24
Diencephalon
Hypothalamus
Mesencephalon
 
25
stage 25
stage 25
stage 25
Diencephalon
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.31562

Mouse

EmageMGI:1202879
EurexpressMGI:1202879
MGI GXDMGI:1202879

Frog

Xenbase485974

Fruit Fly

BDGPFBgn0085432

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-991110-8
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona