GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TNC
tenascin C

Gene
Official SymbolTNC
Official Full Nametenascin C
CGNC ID49806
also known asGMEM, JI, TN, TN-C, tenascin|GP 150-225|cytotactin|glioma-associated-extracellular matrix antigen|hexabrachion|myotendinous antigen|neuronectin, Tenascin precursor (TN), Tenascin-C (TN-C), Hexabrachion, Cytotactin, Neuronectin, GMEM, JI, Glioma- associated-extracellular matrix antigen, GP 150-225, Myotendinous antigen
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205456
PolypeptideNP_990787
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.51524
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human3371ENSG00000041982MIM:187380
Mouse21923ENSMUSG00000028364All phenotypic alleles (5):Targeted, knock-out(2) Targeted, other(3) MGI:101922
Xenopus100494697, 3983321002815
Zebrafish30037ENSDARG00000021948ZDB-GENE-980526-104ZFIN:ZDB-GENE-980526-104
Gene Ontology
Molecular Function
Biological Processcell adhesion
Cellular Componentproteinaceous extracellular matrix
Links to other databases
Entrez Gene396440
Ensembl GeneENSGALG00000007113
KEGGgga:396440

Entry 1

GEISHA Idtenascin.zhao.2007Data SourcePublication
Complete cDNA Template Probeshow
GCGAATTATCCGGCAGAAGCGGGAGACTGGGCTCAATGTGACCTTACCAGAGGATAATCAGCCTGTGGTTTTCAATCAT
GTCTACAACATCAAGCTGCCTGTTGGCTCCCTTTGCTCTGTGGACCTGGACACAGCAAGCGGGGACGCAGACCTGAAGG
CAGAAATTGAGCCTGTCAAGAATTACGAGGAGCATACGGTGAATGAGGGGAACCAGATTGTCTTCACGCACCGCATCAA
CATTCCCCGCCGGGCCTGTGGCTGTGCGGCTGCCCCAGACATCAAGGACCTGCTGAGCAGACTGGAGGAGCTGGAGGGG
CTGGTATCCTCCCTCCGGGAGCAGTGTGCCAGCGGGGCTGGATGCTGTCCTAATTCCCAGACAGCAGAAGGTAAGGCAG
GCTGGGGAGCCACACGGGGAAATTCTCATGCTGGCAGCAGATTTTGTTTAGAGTAGATACTCGAATCTGTTTCAAGAAA
GAACAAAAGTCAACCTGTTAAATTCGAAATGTAATCAATGCGTTTGCCAGCTTGGTTCATTCACAGTTCTAGTTTTATG
GATCTGTGGGTCAGATGTTTGTCTGGGCCTTGTAGCTGTGGCATTGAGCAAGTATGGCACTTGGACAAGGTGACAGTGT
GGGAGTTGAGATTAAAACTCGCACAGCCCAAGGTTTTGGCTCCACATGTTGTCCCTTTGAGCAGGCTGCCAATGTAACT
GTTTTAACGTCCAAGTTTTCTTTAATAGAGACCAATAAAAATACAGCGGGATGTAGGCAATAGATTAGAA
CitationZhao B, Etter L, Hinton RB Jr, Benson DW. BMP and FGF regulatory pathways in semilunar valve precursor cells. Dev Dyn. 2007 Apr;236(4):971-80.
CopyrightCopyright © 2007 Wiley-Liss, Inc.
CommentsAccession number given in paper. Forward probe primer: GCGAATTATCCGGCAGAAGC. Reverse probe primer: TTCTAATCTATTGCCTACATCC.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
Aorta
Valves
 
31-37
stage 37
Valves
 

Entry 2

GEISHA IdTNC.Domowicz.2008Data SourcePublication
Complete cDNA Template Probeshow
GGCTGATCTGACCAGTGTGCCGCACTGTCAAACCCTCCTTTCACACACGCGCGCACCAAATGAGACGGCACAACTTCTC
TGAGTTTTGACAGGACGGCGAGGAATCCGGGAGCCGACAGCTGGCTGCAGTACCTCTGCTTCGTGGAGGCTGCCCGTGG
CAGGATCTGATCCGTCAGCCCACACGAGAATAAGTGTGCCAAGAAAGGAAAGGAAACTCAACTTAGTTTGAACTGGCTC
TCAAATTTCTCCTCCAGTCTACAAAGGCCAAACAAATATAAGACTCCATCAGCTTTGAAAAGGAACTGAGCACTACAAT
GGGACTCCCTTCCCAGGTTTTGGCCTGTGCCATCTTAGGTTTGCTGTACCAGCATGCCAGTGGTGGGCTCATCAAGCGA
ATTATCCGGCAGAAGCGGGAGACTGGGCTCAATGTGACCTTACCAGAGGATAATCAGCCTGTGGTTTTCAATCATGTCT
ACAACATCAAGCTGCCTGTTGGCTCCCTTTGCTCTGTGGACCTGGACACAGCAAGTGGGGACGCAGACCTGAAGGCAGA
AATTGAGCCTGTCAAGAATTACGAGGAGCATACGGTGAATGAGGGGAACCAGATTGTCTTCACGCACCGCATCAACATT
CCCCGCCGGGCCTGTGGCTGTGCGGCTGCCCCAGACATCAAGGACCTGCTGAGCAGACTGGAGGAGCTGGAGGGGCTGG
TATCCTCCCTCCGGGAGCAGTGTGCCAGCGGGGCTGGATGCTGTCCTAATTCCCAGACAGCAGAAGGTCGCCTGGACAC
GGCCCCCTATTGCAGTGGGCACGGCAACTACAGCACCGAGATCTGTGGCTGCGTGTGCGAGCCAGGCTGGAAAGGCCCC
AACTGCTCCGAACCGGCCTGCCCACGCAACTGCCTCAACCGCGGCCTCTGCGTGCGGGGCAAATGCATCTGCGAGGAGG
GCTTTACCGGCGAGGACTGCAGCCAGGCTGCCTGCCCGTCTGACTGCAACGACCAAGGCAAGTGTGTGGATGGGGTGTG
CGTCTGCTTCGAGGGCTACACGGGCCCGGACTGCGGCGAGGAGCTCTGCCCCCACGGGTGTGGCATTCACGGGCGCTGT
GTGGGTGGACGCTGTGTGTGCCACGAGGGCTTCACTGGCGAGGACTGCAATGAGCCTCTGTGCCCCAACAACTGTCACA
ACCGCGGGCGCTGTGTGGACAACGAGTGCGTCTGCGATGAGGGCTACACGGGAGAGGACTGCGGCGAGCTGATTTGCCC
CAATGACTGCTTTGACCGCGGGCGCTGCATCAATGGGACCTGCTTCTGCGAGGAGGGCTACACTGGAGAGGACTGCGGC
GAGCTGACCTGCCCCAACAACTGCAACGGCAACGGGCGCTGTGAGAACGGGCTGTGTGTGTGCCATGAGGGCTTCGTGG
GGGATGACTGCAGCCAGAAGAGGTGCCCGAAGGACTGCAATAACCGCGGGCGCTGCGTGGATGGGCGCTGTGTGTGCCA
TGAGGGGTACCTGGGGGAGGACTGTGGGGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTCAACGGG
CAGTGTGTGTGTGATGAGGGATTCATTGGGGAGGACTGTGGAGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGC
GCTGCGTCAATGGGCAGTGCGAGTGCCACGAGGGATTCATCGGGGAGGACTGCGGGGAGCTGCGGTGTCCCAACGACTG
CAACAGCCATGGGCGCTGTGTCAATGGGCAGTGCGTGTGTGATGAGGGGTACACAGGGGAGGACTGCGGGGAGTTGCGG
TGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTGGAGGGACGCTGTGTGTGTGACAACGGCTTCATGGGGGAGGACT
GCGGGGAGCTGTCCTGTCCCAATGACTGCCACCAGCACGGGCGCTGCGTCGATGGGCGCTGCGTGTGCCATGAGGACTT
CACTGGGGAAGACTGCCGGGAACGGTCCTGCCCCAATGACTGCAACAACGTGGGCCGCTGTGTCGAGGGACGGTGTGTC
TGTGAGGAAGGTTACATGGGGATCGACTGTTCTGATGTGTCTCCTCCAACAGAGCTGACTGTAACGAATGTAACAGATA
AAACGGTAAATCTGGAATGGAAGCATGAGAATCTCGTCAATGAGTACCTTGTCACCTATGTCCCTACCAGCAGTGGTGG
CTTAGATCTACAGTTCACCGTACCAGGAAACCAGACATCTGCCACTATTCATGAGCTGGAGCCTGGTGTGGAATACTTC
ATCCGTGTCTTTGCAATCCTTAAAAACAAGAAAAGTATTCCAGTCAGTGCCAGAGTAGCGACATATTTGCCTGCTCCAG
AAGGTCTGAAATTCAAATCTGTTAGAGAAACGTCTGTCCAGGTGGAATGGGATCCTCTGAGCATTTCCTTTGATGGCTG
GGAGCTGGTCTTTCGTAATATGCAGAAAAAGGATGATAATGGAGACATAACCAGCAGCTTGAAAAGGCCGGAGACATCA
TATATGCAGCCAGGATTGGCACCAGGACAACAGTATAATGTATCCCTTCATATAGTGAAAAACAATACCAGAGGACCAG
GGCTATCCCGAGTGATAACCACAAAACTCGATGCCCCTAGCCAGATTGAAGCGAAAGATGTCACAGACACCACAGCTCT
GATCACATGGTCCAAACCCTTGGCTGAAATTGAAGGCATAGAGCTCACATATGGCCCCAAGGATGTTCCAGGGGACAGG
ACTACCATTGACCTCTCTGAGGATGAAAACCAATATTCTATTGGAAACCTGAGGCCACACACAGAATATGAAGTGATAC
TCATTTCTCGGCGAGGGGACATGGAGAGTGACCCTGCAAAAGAAGTCTTTGTCACAGACTTGGATGCTCCACGAAACCT
GAAGCGAGTGTCACAGACAGACAACAGCATTACTTTGGAGTGGAAGAACAGCCATGCAAATATTGATAATTACCGAATT
AAGTTTGCTCCCATTTCTGGTGGAGACCACACTGAGCTGACAGTGCCAAAGGGCAACCAAGCAACAACCAGAGCTACAC
TCACAGGTTTGAGACCTGGAACTGAATATGGCATTGGAGTGACAGCAGTGAGACAGGACAGGGAAAGTGCTCCTGCTAC
CATTAATGCTGGCACTGATCTTGATAACCCCAAGGACTTGGAAGTCAGTGACCCCACTGAAACCACCCTGTCCCTTCGC
TGGAGAAGACCAGTGGCCAAATTTGATCGTTACCGCCTCACTTACGTTAGCCCCTCTGGAAAGAAGAACGAAGTGGAGA
TCCCTGTGGACAGTACCTCTTTTATCCTGAGAGGATTAGACGCAGGGACGGAGTACACCATCAGTCTAGTGGCAGAGAA
GGGCAGACACAAAAGCAAACCCACAACCATCAAGGGTTCGACTGAGGAAGAACCTGAGCTTGGAAACTTATCAGTGTCA
GAGACTGGCTGGGATGGTTTCCAGCTCACCTGGACAGCAGCCGACGGGGCCTATGAGAACTTTGTCATTCAGGTGCAGC
AGTCTGACAATCCAGAAGAAACCTGGAACATTACAGTCCCCGGCGTACAGCACTCTGTGAACGTTACAGGCCTCAAGGC
CAACACACCTTATAACGTCACACTTTATGGTGTGATTCGAGGCTACAGAACCAAACCCCTTTATGTTGAAACCACGACA
GGAGCACACCCTGAAGTTGGTGAGCTAACCGTTTCCGACATTACTCCTGAAAGCTTCAACCTTTCTTGGACGACCACCA
GCGGGGACTTTGACGCCTTTACTATTGAAATTATTGATTCTAACAGGTTGCTGGAGCCCATGGAGTTCAACATCTCAGG
CAATTCAAGAACAGCTCATATCTCAGGGCTTTCCCCCAGCACTGATTTTATTGTCTACCTCTATGGGATCTCTCATGGT
TTCCGCACACAGGCAATAAGTGCTGCGGCTACAACAGAGGCAGAACCCGAGGTGGACAACCTTCTGGTTTCAGATGCTA
CCCCTGACGGCTTCCGTCTGTCCTGGACTGCAGATGATGGGGTTTTCGACAGTTTTGTTCTAAAAATCAGGGATACCAA
AAGGAAATCTGATCCACTGGAACTCATAGTACCAGGCCATGAGCGCACCCATGATATAACAGGGCTGAAAGAGGGCACT
GAGTATGAAATTGAGCTCTATGGAGTTAGCAGTGGACGGCGCTCCCAACCCATAAATTCAGTAGCAACCACAGTTGTGG
GATCTCCCAAGGGAATCTCTTTCTCGGACATCACAGAAAACTCTGCTACAGTCAGCTGGACGCCCCCCCGCAGCCGTGT
GGATAGCTACAGGGTCTCCTATGTCCCCATCACAGGCGGCACTCCCAATGTTGTTACAGTTGATGGAAGCAAGACAAGG
ACAAAGCTGGTGAAGTTAGTCCCAGGTGTAGACTACAACGTTAATATCATCTCTGTGAAAGGCTTTGAAGAAAGCGAAC
CCATTTCTGGAATTCTGAAAACAGCTCTGGACAGCCCGTCAGGACTGGTAGTGATGAACATTACAGACTCGGAGGCTCT
GGCAACCTGGCAGCCTGCAATTGCAGCTGTGGATAATTACATTGTCTCCTACTCTTCTGAGGATGAGCCAGAAGTTACA
CAGATGGTATCAGGAAACACAGTGGAGTACGACCTGAATGGCCTTCGACCTGCGACAGAGTACACCCTGAGGGTGCATG
CAGTGAAGGATGCGCAGAAGAGCGAGACCCTCTCCACCCAGTTCACTACAGGACTCGATGCTCCAAAAGATTTAAGTGC
TACCGAGGTTCAGTCAGAAACAGCTGTGATAACGTGGAGGCCTCCACGTGCTCCTGTCACTGATTACCTCCTGACCTAC
GAGTCCATTGATGGCAGAGTCAAGGAAGTCATCCTAGACCCTGAGACGACCTCCTACACCCTGACAGAGCTGAGCCCAT
CCACTCAATACACAGTGAAACTTCAGGCACTGAGCAGATCTATGAGGAGCAAAATGATCCAGACTGTTTTCACCACAAC
TGGTCTTCTTTATCCTTATCCTAAAGACTGCTCCCAAGCTCTCCTGAATGGAGAGGTCACCTCTGGGCTCTACACTATT
TATCTGAATGGAGACAGGACACAGCCTCTGCAAGTCTTCTGTGACATGGCTGAAGATGGAGGTGGATGGATTGTGTTCC
TGAGGCGTCAAAATGGAAAGGAAGATTTCTACAGGAACTGGAAGAATTACGTGGCCGGCTTTGGAGATCCCAAGGATGA
ATTCTGGATAGGTCTGGAGAACCTCCACAAAATCAGCTCTCAGGGGCAGTACGAGCTGCGTGTGGATCTGAGAGACAGA
GGTGAGACAGCCTATGCTGTGTACGACAAGTTCAGCGTTGGAGATGCCAAGACCCGGTACCGGCTGAGGGTGGATGGCT
ACAGTGGCACAGCAGGTGACTCCATGACCTACCATAATGGAAGATCCTTCTCCACTTTTGACAAGGACAATGATTCTGC
TATCACCAACTGTGCTTTGTCATACAAGGGTGCTTTCTGGTACAAGAATTGTCACCGAGTCAATCTGATGGGCAGATAT
GGTGACAACAACCACAGTCAGGGTGTTAATTGGTTCCACTGGAAGGGCCACGAATACTCCATCCAGTTTGCAGAGATGA
AACTGAGACCCTCCAGCTTTCGGAATCTGGAAGGAAGACGAAAGCGAGCATAAAGCCTTGGGATGGTGAAAGGGCTACG
GGCAGGGCAACATGGGGAGGGACAGAGAGCGGGGGGCATGGGAGGATCTCTGGCATCACTGGGGTGATGGGTGTGAGGA
GCTGGTAGTCGTACCAAAGCATCGCAACCCTTGGCACAAGAGCCCAAACAACGAGCCTTACGTGTCCCAGCAATTCCAG
CAGAGCAGCTCCAGCTCTGCCCACTGCTGATGTCCTTCACGCCAAAGACAACGATCTCAAGGGTTGTATGCTGTTTTCT
TCATTTTTCTTTTCTCAGCCTCTGGGATGAAGTTCTTCCACGGTCTGACTATCTCTTGGGTGGCCCAGGGTAGGGGAGG
GAGAACAGCTTTGTATATTGGTAGTTTGTTTTAGAACCAGCCATATTTTTTACACACAGAAATGTGTATGATTAATTAT
CATTATTATTATTATTAGATATAATTGAAATCCTTTGGTTGTTGGAAAGCCTTTTTTTATATATATATCAAGTACCACA
GAGAAGAAGGGGGGGGGGGGGGGGGGAGAGGGAAAGCAGTACATTTTTAAACTTGAGCAAAAAAATTAATATTATTAAT
ATAATGACAAAGTAATAATAATAATGATAATAATAAGCTAAGTTTTTGTCATTTTTAAGAGAACAATGCTTTTGGGAAC
ACAGCAGGACAGTGTCTGATTGTAAATTTCTTTTTTTAAATAAAAGCACAATTACTTTTAAATAAATTTCTACCTTTTT
TTTTTTTTTTTTCATACTTGTTGAGTTGGTGCATGTCCAGGGTATCTGTACGTACATGGGGAAGTAAAAGGCTGAAAAT
GATCAGGCTGCTGAGCCCGTACTGAAAACTGTTCCTTTTGTTAGTGGTTAGCTGTAAGAATTCTGCTGGGTTTCTTGCA
GCGAAAGGTCCTTATGGATTTGATTTCTTTTAGAACACATTTCTTTTCTTTTTCCTGCCCAAAAGCTTTTACACGTTTT
TCTCAGTGTTACTGACCAACGCTTGCTCCATCTAGGTGGGAATAACTAACAAAAGAAAACAAGAAAAGCACAGAGTTGT
TGTTAGGTACCATTGGTGACTTTGAACACTTGTGTAAATAAAGGGCTCTCTTTTTGTATGAATGAAACCTATGTGTAGT
TCCTCTGTATCATGCTCTTCAGTTGGAGACAATAAAAGATCTTTTGTTTTAA
CitationDomowicz MS, Sanders TA, Ragsdale CW, Schwartz NB. Aggrecan is expressed by embryonic brain glia and regulates astrocyte development. Dev Biol. 2008 Mar 1;315(1):114-24. Epub 2008 Jan 22.
CopyrightCopyright © 2008 Published by Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205456).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-38
stage 38
stage 38
Hindbrain
 

Entry 3

GEISHA IdTNC.Roddy.2011Data SourcePublication
Complete cDNA Template Probeshow
GATCGACTGTTCTGATGTGTCTCCTCCAACAGAGCTGACTGTAACGAATGTAACAGATAAAACGGTAAATCTGGAATGG
AAGCATGAGAATCTCGTCAATGAGTACCTTGTCACCTATGTCCCTACCAGCAGTGGTGGCTTAGATCTACAGTTCACCG
TACCAGGAAACCAGACATCTGCCACTATTCATGAGCTGGAGCCTGGTGTGGAATACTTCATCCGTGTCTTTGCAATCCT
TAAAAACAAGAAAAGTATTCCAGTCAGTGCCAGAGTAGCGACATATTTGCCTGCTCCAGAAGGTCTGAAATTCAAATCT
GTTAGAGAAACGTCTGTCCAGGTGGAATGGGATCCTCTGAGCATTTCCTTTGATGGCTGGGAGCTGGTCTTTCGTAATA
TGCAGAAAAAGGATGATAATGGAGACATAACCAGCAGCTTGAAAAGGCCGGAGACATCATATATGCAGCCAGGATTGGC
ACCAGGACAACAGTATAATGTATCCCTTCATATAGTGAAAAACAATACCAGAGGACCAGGGCTATCCCGAGTGATAACC
ACAAAACTCGATGCCCCTAGCCAGATTGAAGCGAAAGATGTCACAGACACCACAGCTCTGATCACATGGTCCAAACCCT
TGGCTGAAATTGAAGGCATAGAGCTCACATATGGCCCCAAGGATGTTCCAGGGGACAGGACTACCATTGACCTCTCTGA
GGATGAAAACCAATATTCTATTGG
CitationRoddy KA, Prendergast PJ, Murphy P. Mechanical influences on morphogenesis of the knee joint revealed through morphological, molecular and computational analysis of immobilised embryos. PLoS One. 2011 Feb 28;6(2):e17526.
CopyrightPLoS One is an open access journal.
CommentsThe cDNA template used to generate the probe was obtained from EST - ChEST681L9 as described in Roddy et al.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-27
stage 27
stage 27
stage 27
Leg
control

Entry 4

GEISHA IdCT.Prieto.1990Data SourcePublication
Complete cDNA Template Probeshow
GGCTGATCTGACCAGTGTGCCGCACTGTCAAACCCTCCTTTCACACACGCGCGCACCAAATGAGACGGCACAACTTCTC
TGAGTTTTGACAGGACGGCGAGGAATCCGGGAGCCGACAGCTGGCTGCAGTACCTCTGCTTCGTGGAGGCTGCCCGTGG
CAGGATCTGATCCGTCAGCCCACACGAGAATAAGTGTGCCAAGAAAGGAAAGGAAACTCAACTTAGTTTGAACTGGCTC
TCAAATTTCTCCTCCAGTCTACAAAGGCCAAACAAATATAAGACTCCATCAGCTTTGAAAAGGAACTGAGCACTACAAT
GGGACTCCCTTCCCAGGTTTTGGCCTGTGCCATCTTAGGTTTGCTGTACCAGCATGCCAGTGGTGGGCTCATCAAGCGA
ATTATCCGGCAGAAGCGGGAGACTGGGCTCAATGTGACCTTACCAGAGGATAATCAGCCTGTGGTTTTCAATCATGTCT
ACAACATCAAGCTGCCTGTTGGCTCCCTTTGCTCTGTGGACCTGGACACAGCAAGTGGGGACGCAGACCTGAAGGCAGA
AATTGAGCCTGTCAAGAATTACGAGGAGCATACGGTGAATGAGGGGAACCAGATTGTCTTCACGCACCGCATCAACATT
CCCCGCCGGGCCTGTGGCTGTGCGGCTGCCCCAGACATCAAGGACCTGCTGAGCAGACTGGAGGAGCTGGAGGGGCTGG
TATCCTCCCTCCGGGAGCAGTGTGCCAGCGGGGCTGGATGCTGTCCTAATTCCCAGACAGCAGAAGGTCGCCTGGACAC
GGCCCCCTATTGCAGTGGGCACGGCAACTACAGCACCGAGATCTGTGGCTGCGTGTGCGAGCCAGGCTGGAAAGGCCCC
AACTGCTCCGAACCGGCCTGCCCACGCAACTGCCTCAACCGCGGCCTCTGCGTGCGGGGCAAATGCATCTGCGAGGAGG
GCTTTACCGGCGAGGACTGCAGCCAGGCTGCCTGCCCGTCTGACTGCAACGACCAAGGCAAGTGTGTGGATGGGGTGTG
CGTCTGCTTCGAGGGCTACACGGGCCCGGACTGCGGCGAGGAGCTCTGCCCCCACGGGTGTGGCATTCACGGGCGCTGT
GTGGGTGGACGCTGTGTGTGCCACGAGGGCTTCACTGGCGAGGACTGCAATGAGCCTCTGTGCCCCAACAACTGTCACA
ACCGCGGGCGCTGTGTGGACAACGAGTGCGTCTGCGATGAGGGCTACACGGGAGAGGACTGCGGCGAGCTGATTTGCCC
CAATGACTGCTTTGACCGCGGGCGCTGCATCAATGGGACCTGCTTCTGCGAGGAGGGCTACACTGGAGAGGACTGCGGC
GAGCTGACCTGCCCCAACAACTGCAACGGCAACGGGCGCTGTGAGAACGGGCTGTGTGTGTGCCATGAGGGCTTCGTGG
GGGATGACTGCAGCCAGAAGAGGTGCCCGAAGGACTGCAATAACCGCGGGCGCTGCGTGGATGGGCGCTGTGTGTGCCA
TGAGGGGTACCTGGGGGAGGACTGTGGGGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTCAACGGG
CAGTGTGTGTGTGATGAGGGATTCATTGGGGAGGACTGTGGAGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGC
GCTGCGTCAATGGGCAGTGCGAGTGCCACGAGGGATTCATCGGGGAGGACTGCGGGGAGCTGCGGTGTCCCAACGACTG
CAACAGCCATGGGCGCTGTGTCAATGGGCAGTGCGTGTGTGATGAGGGGTACACAGGGGAGGACTGCGGGGAGTTGCGG
TGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTGGAGGGACGCTGTGTGTGTGACAACGGCTTCATGGGGGAGGACT
GCGGGGAGCTGTCCTGTCCCAATGACTGCCACCAGCACGGGCGCTGCGTCGATGGGCGCTGCGTGTGCCATGAGGACTT
CACTGGGGAAGACTGCCGGGAACGGTCCTGCCCCAATGACTGCAACAACGTGGGCCGCTGTGTCGAGGGACGGTGTGTC
TGTGAGGAAGGTTACATGGGGATCGACTGTTCTGATGTGTCTCCTCCAACAGAGCTGACTGTAACGAATGTAACAGATA
AAACGGTAAATCTGGAATGGAAGCATGAGAATCTCGTCAATGAGTACCTTGTCACCTATGTCCCTACCAGCAGTGGTGG
CTTAGATCTACAGTTCACCGTACCAGGAAACCAGACATCTGCCACTATTCATGAGCTGGAGCCTGGTGTGGAATACTTC
ATCCGTGTCTTTGCAATCCTTAAAAACAAGAAAAGTATTCCAGTCAGTGCCAGAGTAGCGACATATTTGCCTGCTCCAG
AAGGTCTGAAATTCAAATCTGTTAGAGAAACGTCTGTCCAGGTGGAATGGGATCCTCTGAGCATTTCCTTTGATGGCTG
GGAGCTGGTCTTTCGTAATATGCAGAAAAAGGATGATAATGGAGACATAACCAGCAGCTTGAAAAGGCCGGAGACATCA
TATATGCAGCCAGGATTGGCACCAGGACAACAGTATAATGTATCCCTTCATATAGTGAAAAACAATACCAGAGGACCAG
GGCTATCCCGAGTGATAACCACAAAACTCGATGCCCCTAGCCAGATTGAAGCGAAAGATGTCACAGACACCACAGCTCT
GATCACATGGTCCAAACCCTTGGCTGAAATTGAAGGCATAGAGCTCACATATGGCCCCAAGGATGTTCCAGGGGACAGG
ACTACCATTGACCTCTCTGAGGATGAAAACCAATATTCTATTGGAAACCTGAGGCCACACACAGAATATGAAGTGATAC
TCATTTCTCGGCGAGGGGACATGGAGAGTGACCCTGCAAAAGAAGTCTTTGTCACAGACTTGGATGCTCCACGAAACCT
GAAGCGAGTGTCACAGACAGACAACAGCATTACTTTGGAGTGGAAGAACAGCCATGCAAATATTGATAATTACCGAATT
AAGTTTGCTCCCATTTCTGGTGGAGACCACACTGAGCTGACAGTGCCAAAGGGCAACCAAGCAACAACCAGAGCTACAC
TCACAGGTTTGAGACCTGGAACTGAATATGGCATTGGAGTGACAGCAGTGAGACAGGACAGGGAAAGTGCTCCTGCTAC
CATTAATGCTGGCACTGATCTTGATAACCCCAAGGACTTGGAAGTCAGTGACCCCACTGAAACCACCCTGTCCCTTCGC
TGGAGAAGACCAGTGGCCAAATTTGATCGTTACCGCCTCACTTACGTTAGCCCCTCTGGAAAGAAGAACGAAGTGGAGA
TCCCTGTGGACAGTACCTCTTTTATCCTGAGAGGATTAGACGCAGGGACGGAGTACACCATCAGTCTAGTGGCAGAGAA
GGGCAGACACAAAAGCAAACCCACAACCATCAAGGGTTCGACTGAGGAAGAACCTGAGCTTGGAAACTTATCAGTGTCA
GAGACTGGCTGGGATGGTTTCCAGCTCACCTGGACAGCAGCCGACGGGGCCTATGAGAACTTTGTCATTCAGGTGCAGC
AGTCTGACAATCCAGAAGAAACCTGGAACATTACAGTCCCCGGCGTACAGCACTCTGTGAACGTTACAGGCCTCAAGGC
CAACACACCTTATAACGTCACACTTTATGGTGTGATTCGAGGCTACAGAACCAAACCCCTTTATGTTGAAACCACGACA
GGAGCACACCCTGAAGTTGGTGAGCTAACCGTTTCCGACATTACTCCTGAAAGCTTCAACCTTTCTTGGACGACCACCA
GCGGGGACTTTGACGCCTTTACTATTGAAATTATTGATTCTAACAGGTTGCTGGAGCCCATGGAGTTCAACATCTCAGG
CAATTCAAGAACAGCTCATATCTCAGGGCTTTCCCCCAGCACTGATTTTATTGTCTACCTCTATGGGATCTCTCATGGT
TTCCGCACACAGGCAATAAGTGCTGCGGCTACAACAGAGGCAGAACCCGAGGTGGACAACCTTCTGGTTTCAGATGCTA
CCCCTGACGGCTTCCGTCTGTCCTGGACTGCAGATGATGGGGTTTTCGACAGTTTTGTTCTAAAAATCAGGGATACCAA
AAGGAAATCTGATCCACTGGAACTCATAGTACCAGGCCATGAGCGCACCCATGATATAACAGGGCTGAAAGAGGGCACT
GAGTATGAAATTGAGCTCTATGGAGTTAGCAGTGGACGGCGCTCCCAACCCATAAATTCAGTAGCAACCACAGTTGTGG
GATCTCCCAAGGGAATCTCTTTCTCGGACATCACAGAAAACTCTGCTACAGTCAGCTGGACGCCCCCCCGCAGCCGTGT
GGATAGCTACAGGGTCTCCTATGTCCCCATCACAGGCGGCACTCCCAATGTTGTTACAGTTGATGGAAGCAAGACAAGG
ACAAAGCTGGTGAAGTTAGTCCCAGGTGTAGACTACAACGTTAATATCATCTCTGTGAAAGGCTTTGAAGAAAGCGAAC
CCATTTCTGGAATTCTGAAAACAGCTCTGGACAGCCCGTCAGGACTGGTAGTGATGAACATTACAGACTCGGAGGCTCT
GGCAACCTGGCAGCCTGCAATTGCAGCTGTGGATAATTACATTGTCTCCTACTCTTCTGAGGATGAGCCAGAAGTTACA
CAGATGGTATCAGGAAACACAGTGGAGTACGACCTGAATGGCCTTCGACCTGCGACAGAGTACACCCTGAGGGTGCATG
CAGTGAAGGATGCGCAGAAGAGCGAGACCCTCTCCACCCAGTTCACTACAGGACTCGATGCTCCAAAAGATTTAAGTGC
TACCGAGGTTCAGTCAGAAACAGCTGTGATAACGTGGAGGCCTCCACGTGCTCCTGTCACTGATTACCTCCTGACCTAC
GAGTCCATTGATGGCAGAGTCAAGGAAGTCATCCTAGACCCTGAGACGACCTCCTACACCCTGACAGAGCTGAGCCCAT
CCACTCAATACACAGTGAAACTTCAGGCACTGAGCAGATCTATGAGGAGCAAAATGATCCAGACTGTTTTCACCACAAC
TGGTCTTCTTTATCCTTATCCTAAAGACTGCTCCCAAGCTCTCCTGAATGGAGAGGTCACCTCTGGGCTCTACACTATT
TATCTGAATGGAGACAGGACACAGCCTCTGCAAGTCTTCTGTGACATGGCTGAAGATGGAGGTGGATGGATTGTGTTCC
TGAGGCGTCAAAATGGAAAGGAAGATTTCTACAGGAACTGGAAGAATTACGTGGCCGGCTTTGGAGATCCCAAGGATGA
ATTCTGGATAGGTCTGGAGAACCTCCACAAAATCAGCTCTCAGGGGCAGTACGAGCTGCGTGTGGATCTGAGAGACAGA
GGTGAGACAGCCTATGCTGTGTACGACAAGTTCAGCGTTGGAGATGCCAAGACCCGGTACCGGCTGAGGGTGGATGGCT
ACAGTGGCACAGCAGGTGACTCCATGACCTACCATAATGGAAGATCCTTCTCCACTTTTGACAAGGACAATGATTCTGC
TATCACCAACTGTGCTTTGTCATACAAGGGTGCTTTCTGGTACAAGAATTGTCACCGAGTCAATCTGATGGGCAGATAT
GGTGACAACAACCACAGTCAGGGTGTTAATTGGTTCCACTGGAAGGGCCACGAATACTCCATCCAGTTTGCAGAGATGA
AACTGAGACCCTCCAGCTTTCGGAATCTGGAAGGAAGACGAAAGCGAGCATAAAGCCTTGGGATGGTGAAAGGGCTACG
GGCAGGGCAACATGGGGAGGGACAGAGAGCGGGGGGCATGGGAGGATCTCTGGCATCACTGGGGTGATGGGTGTGAGGA
GCTGGTAGTCGTACCAAAGCATCGCAACCCTTGGCACAAGAGCCCAAACAACGAGCCTTACGTGTCCCAGCAATTCCAG
CAGAGCAGCTCCAGCTCTGCCCACTGCTGATGTCCTTCACGCCAAAGACAACGATCTCAAGGGTTGTATGCTGTTTTCT
TCATTTTTCTTTTCTCAGCCTCTGGGATGAAGTTCTTCCACGGTCTGACTATCTCTTGGGTGGCCCAGGGTAGGGGAGG
GAGAACAGCTTTGTATATTGGTAGTTTGTTTTAGAACCAGCCATATTTTTTACACACAGAAATGTGTATGATTAATTAT
CATTATTATTATTATTAGATATAATTGAAATCCTTTGGTTGTTGGAAAGCCTTTTTTTATATATATATCAAGTACCACA
GAGAAGAAGGGGGGGGGGGGGGGGGGAGAGGGAAAGCAGTACATTTTTAAACTTGAGCAAAAAAATTAATATTATTAAT
ATAATGACAAAGTAATAATAATAATGATAATAATAAGCTAAGTTTTTGTCATTTTTAAGAGAACAATGCTTTTGGGAAC
ACAGCAGGACAGTGTCTGATTGTAAATTTCTTTTTTTAAATAAAAGCACAATTACTTTTAAATAAATTTCTACCTTTTT
TTTTTTTTTTTTCATACTTGTTGAGTTGGTGCATGTCCAGGGTATCTGTACGTACATGGGGAAGTAAAAGGCTGAAAAT
GATCAGGCTGCTGAGCCCGTACTGAAAACTGTTCCTTTTGTTAGTGGTTAGCTGTAAGAATTCTGCTGGGTTTCTTGCA
GCGAAAGGTCCTTATGGATTTGATTTCTTTTAGAACACATTTCTTTTCTTTTTCCTGCCCAAAAGCTTTTACACGTTTT
TCTCAGTGTTACTGACCAACGCTTGCTCCATCTAGGTGGGAATAACTAACAAAAGAAAACAAGAAAAGCACAGAGTTGT
TGTTAGGTACCATTGGTGACTTTGAACACTTGTGTAAATAAAGGGCTCTCTTTTTGTATGAATGAAACCTATGTGTAGT
TCCTCTGTATCATGCTCTTCAGTTGGAGACAATAAAAGATCTTTTGTTTTAA
CitationPrieto AL, Jones FS, Cunningham BA, Crossin KL, Edelman GM. Localization during development of alternatively spliced forms of cytotactin mRNA by in situ hybridization. J Cell Biol. 1990 Aug;111(2):685-98.
Copyright© The Rockefeller University Press
CommentsAuthors indicated "one probe (CT) contained 2,028 nucleotides corresponding to a region that is present in all forms of cytotactin analyzed thus far. It encodes a segment that spans the last four epidermal growth factor-like repeats and six fibronectin type III repeats (I-VI)." As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205456.2)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
Aorta
Dermomyotome
 
31-44
stage 34
stage 34
stage 35
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 41
stage 41
stage 42
stage 42
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
Ectoderm
Eye
Feathers/Scutae
Gizzard
Hindbrain
Leg Mesenchyme
Lung
Metencephalon
Midbrain
Renal
Sclerotome
Spinal Cord
Surface Ectoderm
Telencephalon
Trunk Mesenchyme
Hatched
Hatched, stage unspecified
choroid plexus
hatchling
optic tecta
rib cage

Entry 5

GEISHA IdVbVc.Prieto.1990Data SourcePublication
Complete cDNA Template Probeshow
GGCTGATCTGACCAGTGTGCCGCACTGTCAAACCCTCCTTTCACACACGCGCGCACCAAATGAGACGGCACAACTTCTC
TGAGTTTTGACAGGACGGCGAGGAATCCGGGAGCCGACAGCTGGCTGCAGTACCTCTGCTTCGTGGAGGCTGCCCGTGG
CAGGATCTGATCCGTCAGCCCACACGAGAATAAGTGTGCCAAGAAAGGAAAGGAAACTCAACTTAGTTTGAACTGGCTC
TCAAATTTCTCCTCCAGTCTACAAAGGCCAAACAAATATAAGACTCCATCAGCTTTGAAAAGGAACTGAGCACTACAAT
GGGACTCCCTTCCCAGGTTTTGGCCTGTGCCATCTTAGGTTTGCTGTACCAGCATGCCAGTGGTGGGCTCATCAAGCGA
ATTATCCGGCAGAAGCGGGAGACTGGGCTCAATGTGACCTTACCAGAGGATAATCAGCCTGTGGTTTTCAATCATGTCT
ACAACATCAAGCTGCCTGTTGGCTCCCTTTGCTCTGTGGACCTGGACACAGCAAGTGGGGACGCAGACCTGAAGGCAGA
AATTGAGCCTGTCAAGAATTACGAGGAGCATACGGTGAATGAGGGGAACCAGATTGTCTTCACGCACCGCATCAACATT
CCCCGCCGGGCCTGTGGCTGTGCGGCTGCCCCAGACATCAAGGACCTGCTGAGCAGACTGGAGGAGCTGGAGGGGCTGG
TATCCTCCCTCCGGGAGCAGTGTGCCAGCGGGGCTGGATGCTGTCCTAATTCCCAGACAGCAGAAGGTCGCCTGGACAC
GGCCCCCTATTGCAGTGGGCACGGCAACTACAGCACCGAGATCTGTGGCTGCGTGTGCGAGCCAGGCTGGAAAGGCCCC
AACTGCTCCGAACCGGCCTGCCCACGCAACTGCCTCAACCGCGGCCTCTGCGTGCGGGGCAAATGCATCTGCGAGGAGG
GCTTTACCGGCGAGGACTGCAGCCAGGCTGCCTGCCCGTCTGACTGCAACGACCAAGGCAAGTGTGTGGATGGGGTGTG
CGTCTGCTTCGAGGGCTACACGGGCCCGGACTGCGGCGAGGAGCTCTGCCCCCACGGGTGTGGCATTCACGGGCGCTGT
GTGGGTGGACGCTGTGTGTGCCACGAGGGCTTCACTGGCGAGGACTGCAATGAGCCTCTGTGCCCCAACAACTGTCACA
ACCGCGGGCGCTGTGTGGACAACGAGTGCGTCTGCGATGAGGGCTACACGGGAGAGGACTGCGGCGAGCTGATTTGCCC
CAATGACTGCTTTGACCGCGGGCGCTGCATCAATGGGACCTGCTTCTGCGAGGAGGGCTACACTGGAGAGGACTGCGGC
GAGCTGACCTGCCCCAACAACTGCAACGGCAACGGGCGCTGTGAGAACGGGCTGTGTGTGTGCCATGAGGGCTTCGTGG
GGGATGACTGCAGCCAGAAGAGGTGCCCGAAGGACTGCAATAACCGCGGGCGCTGCGTGGATGGGCGCTGTGTGTGCCA
TGAGGGGTACCTGGGGGAGGACTGTGGGGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTCAACGGG
CAGTGTGTGTGTGATGAGGGATTCATTGGGGAGGACTGTGGAGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGC
GCTGCGTCAATGGGCAGTGCGAGTGCCACGAGGGATTCATCGGGGAGGACTGCGGGGAGCTGCGGTGTCCCAACGACTG
CAACAGCCATGGGCGCTGTGTCAATGGGCAGTGCGTGTGTGATGAGGGGTACACAGGGGAGGACTGCGGGGAGTTGCGG
TGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTGGAGGGACGCTGTGTGTGTGACAACGGCTTCATGGGGGAGGACT
GCGGGGAGCTGTCCTGTCCCAATGACTGCCACCAGCACGGGCGCTGCGTCGATGGGCGCTGCGTGTGCCATGAGGACTT
CACTGGGGAAGACTGCCGGGAACGGTCCTGCCCCAATGACTGCAACAACGTGGGCCGCTGTGTCGAGGGACGGTGTGTC
TGTGAGGAAGGTTACATGGGGATCGACTGTTCTGATGTGTCTCCTCCAACAGAGCTGACTGTAACGAATGTAACAGATA
AAACGGTAAATCTGGAATGGAAGCATGAGAATCTCGTCAATGAGTACCTTGTCACCTATGTCCCTACCAGCAGTGGTGG
CTTAGATCTACAGTTCACCGTACCAGGAAACCAGACATCTGCCACTATTCATGAGCTGGAGCCTGGTGTGGAATACTTC
ATCCGTGTCTTTGCAATCCTTAAAAACAAGAAAAGTATTCCAGTCAGTGCCAGAGTAGCGACATATTTGCCTGCTCCAG
AAGGTCTGAAATTCAAATCTGTTAGAGAAACGTCTGTCCAGGTGGAATGGGATCCTCTGAGCATTTCCTTTGATGGCTG
GGAGCTGGTCTTTCGTAATATGCAGAAAAAGGATGATAATGGAGACATAACCAGCAGCTTGAAAAGGCCGGAGACATCA
TATATGCAGCCAGGATTGGCACCAGGACAACAGTATAATGTATCCCTTCATATAGTGAAAAACAATACCAGAGGACCAG
GGCTATCCCGAGTGATAACCACAAAACTCGATGCCCCTAGCCAGATTGAAGCGAAAGATGTCACAGACACCACAGCTCT
GATCACATGGTCCAAACCCTTGGCTGAAATTGAAGGCATAGAGCTCACATATGGCCCCAAGGATGTTCCAGGGGACAGG
ACTACCATTGACCTCTCTGAGGATGAAAACCAATATTCTATTGGAAACCTGAGGCCACACACAGAATATGAAGTGATAC
TCATTTCTCGGCGAGGGGACATGGAGAGTGACCCTGCAAAAGAAGTCTTTGTCACAGACTTGGATGCTCCACGAAACCT
GAAGCGAGTGTCACAGACAGACAACAGCATTACTTTGGAGTGGAAGAACAGCCATGCAAATATTGATAATTACCGAATT
AAGTTTGCTCCCATTTCTGGTGGAGACCACACTGAGCTGACAGTGCCAAAGGGCAACCAAGCAACAACCAGAGCTACAC
TCACAGGTTTGAGACCTGGAACTGAATATGGCATTGGAGTGACAGCAGTGAGACAGGACAGGGAAAGTGCTCCTGCTAC
CATTAATGCTGGCACTGATCTTGATAACCCCAAGGACTTGGAAGTCAGTGACCCCACTGAAACCACCCTGTCCCTTCGC
TGGAGAAGACCAGTGGCCAAATTTGATCGTTACCGCCTCACTTACGTTAGCCCCTCTGGAAAGAAGAACGAAGTGGAGA
TCCCTGTGGACAGTACCTCTTTTATCCTGAGAGGATTAGACGCAGGGACGGAGTACACCATCAGTCTAGTGGCAGAGAA
GGGCAGACACAAAAGCAAACCCACAACCATCAAGGGTTCGACTGAGGAAGAACCTGAGCTTGGAAACTTATCAGTGTCA
GAGACTGGCTGGGATGGTTTCCAGCTCACCTGGACAGCAGCCGACGGGGCCTATGAGAACTTTGTCATTCAGGTGCAGC
AGTCTGACAATCCAGAAGAAACCTGGAACATTACAGTCCCCGGCGTACAGCACTCTGTGAACGTTACAGGCCTCAAGGC
CAACACACCTTATAACGTCACACTTTATGGTGTGATTCGAGGCTACAGAACCAAACCCCTTTATGTTGAAACCACGACA
GGAGCACACCCTGAAGTTGGTGAGCTAACCGTTTCCGACATTACTCCTGAAAGCTTCAACCTTTCTTGGACGACCACCA
GCGGGGACTTTGACGCCTTTACTATTGAAATTATTGATTCTAACAGGTTGCTGGAGCCCATGGAGTTCAACATCTCAGG
CAATTCAAGAACAGCTCATATCTCAGGGCTTTCCCCCAGCACTGATTTTATTGTCTACCTCTATGGGATCTCTCATGGT
TTCCGCACACAGGCAATAAGTGCTGCGGCTACAACAGAGGCAGAACCCGAGGTGGACAACCTTCTGGTTTCAGATGCTA
CCCCTGACGGCTTCCGTCTGTCCTGGACTGCAGATGATGGGGTTTTCGACAGTTTTGTTCTAAAAATCAGGGATACCAA
AAGGAAATCTGATCCACTGGAACTCATAGTACCAGGCCATGAGCGCACCCATGATATAACAGGGCTGAAAGAGGGCACT
GAGTATGAAATTGAGCTCTATGGAGTTAGCAGTGGACGGCGCTCCCAACCCATAAATTCAGTAGCAACCACAGTTGTGG
GATCTCCCAAGGGAATCTCTTTCTCGGACATCACAGAAAACTCTGCTACAGTCAGCTGGACGCCCCCCCGCAGCCGTGT
GGATAGCTACAGGGTCTCCTATGTCCCCATCACAGGCGGCACTCCCAATGTTGTTACAGTTGATGGAAGCAAGACAAGG
ACAAAGCTGGTGAAGTTAGTCCCAGGTGTAGACTACAACGTTAATATCATCTCTGTGAAAGGCTTTGAAGAAAGCGAAC
CCATTTCTGGAATTCTGAAAACAGCTCTGGACAGCCCGTCAGGACTGGTAGTGATGAACATTACAGACTCGGAGGCTCT
GGCAACCTGGCAGCCTGCAATTGCAGCTGTGGATAATTACATTGTCTCCTACTCTTCTGAGGATGAGCCAGAAGTTACA
CAGATGGTATCAGGAAACACAGTGGAGTACGACCTGAATGGCCTTCGACCTGCGACAGAGTACACCCTGAGGGTGCATG
CAGTGAAGGATGCGCAGAAGAGCGAGACCCTCTCCACCCAGTTCACTACAGGACTCGATGCTCCAAAAGATTTAAGTGC
TACCGAGGTTCAGTCAGAAACAGCTGTGATAACGTGGAGGCCTCCACGTGCTCCTGTCACTGATTACCTCCTGACCTAC
GAGTCCATTGATGGCAGAGTCAAGGAAGTCATCCTAGACCCTGAGACGACCTCCTACACCCTGACAGAGCTGAGCCCAT
CCACTCAATACACAGTGAAACTTCAGGCACTGAGCAGATCTATGAGGAGCAAAATGATCCAGACTGTTTTCACCACAAC
TGGTCTTCTTTATCCTTATCCTAAAGACTGCTCCCAAGCTCTCCTGAATGGAGAGGTCACCTCTGGGCTCTACACTATT
TATCTGAATGGAGACAGGACACAGCCTCTGCAAGTCTTCTGTGACATGGCTGAAGATGGAGGTGGATGGATTGTGTTCC
TGAGGCGTCAAAATGGAAAGGAAGATTTCTACAGGAACTGGAAGAATTACGTGGCCGGCTTTGGAGATCCCAAGGATGA
ATTCTGGATAGGTCTGGAGAACCTCCACAAAATCAGCTCTCAGGGGCAGTACGAGCTGCGTGTGGATCTGAGAGACAGA
GGTGAGACAGCCTATGCTGTGTACGACAAGTTCAGCGTTGGAGATGCCAAGACCCGGTACCGGCTGAGGGTGGATGGCT
ACAGTGGCACAGCAGGTGACTCCATGACCTACCATAATGGAAGATCCTTCTCCACTTTTGACAAGGACAATGATTCTGC
TATCACCAACTGTGCTTTGTCATACAAGGGTGCTTTCTGGTACAAGAATTGTCACCGAGTCAATCTGATGGGCAGATAT
GGTGACAACAACCACAGTCAGGGTGTTAATTGGTTCCACTGGAAGGGCCACGAATACTCCATCCAGTTTGCAGAGATGA
AACTGAGACCCTCCAGCTTTCGGAATCTGGAAGGAAGACGAAAGCGAGCATAAAGCCTTGGGATGGTGAAAGGGCTACG
GGCAGGGCAACATGGGGAGGGACAGAGAGCGGGGGGCATGGGAGGATCTCTGGCATCACTGGGGTGATGGGTGTGAGGA
GCTGGTAGTCGTACCAAAGCATCGCAACCCTTGGCACAAGAGCCCAAACAACGAGCCTTACGTGTCCCAGCAATTCCAG
CAGAGCAGCTCCAGCTCTGCCCACTGCTGATGTCCTTCACGCCAAAGACAACGATCTCAAGGGTTGTATGCTGTTTTCT
TCATTTTTCTTTTCTCAGCCTCTGGGATGAAGTTCTTCCACGGTCTGACTATCTCTTGGGTGGCCCAGGGTAGGGGAGG
GAGAACAGCTTTGTATATTGGTAGTTTGTTTTAGAACCAGCCATATTTTTTACACACAGAAATGTGTATGATTAATTAT
CATTATTATTATTATTAGATATAATTGAAATCCTTTGGTTGTTGGAAAGCCTTTTTTTATATATATATCAAGTACCACA
GAGAAGAAGGGGGGGGGGGGGGGGGGAGAGGGAAAGCAGTACATTTTTAAACTTGAGCAAAAAAATTAATATTATTAAT
ATAATGACAAAGTAATAATAATAATGATAATAATAAGCTAAGTTTTTGTCATTTTTAAGAGAACAATGCTTTTGGGAAC
ACAGCAGGACAGTGTCTGATTGTAAATTTCTTTTTTTAAATAAAAGCACAATTACTTTTAAATAAATTTCTACCTTTTT
TTTTTTTTTTTTCATACTTGTTGAGTTGGTGCATGTCCAGGGTATCTGTACGTACATGGGGAAGTAAAAGGCTGAAAAT
GATCAGGCTGCTGAGCCCGTACTGAAAACTGTTCCTTTTGTTAGTGGTTAGCTGTAAGAATTCTGCTGGGTTTCTTGCA
GCGAAAGGTCCTTATGGATTTGATTTCTTTTAGAACACATTTCTTTTCTTTTTCCTGCCCAAAAGCTTTTACACGTTTT
TCTCAGTGTTACTGACCAACGCTTGCTCCATCTAGGTGGGAATAACTAACAAAAGAAAACAAGAAAAGCACAGAGTTGT
TGTTAGGTACCATTGGTGACTTTGAACACTTGTGTAAATAAAGGGCTCTCTTTTTGTATGAATGAAACCTATGTGTAGT
TCCTCTGTATCATGCTCTTCAGTTGGAGACAATAAAAGATCTTTTGTTTTAA
CitationPrieto AL, Jones FS, Cunningham BA, Crossin KL, Edelman GM. Localization during development of alternatively spliced forms of cytotactin mRNA by in situ hybridization. J Cell Biol. 1990 Aug;111(2):685-98.
Copyright© The Rockefeller University Press
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #NM_205456.2)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-44
stage 35
stage 35
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 37
stage 41
stage 41
stage 41
stage 44
stage 44
Ectoderm
Feathers/Scutae
Gizzard
Hindbrain
Lung
Midbrain
Sclerotome
Spinal Cord
Hatchling, stage unspecified
cerebella
choroid plexus
optic tecta
rib cage

Entry 6

GEISHA IdCYTOTACTIN.Tan.1991Data SourcePublication
Complete cDNA Template Probeshow
GGCTGATCTGACCAGTGTGCCGCACTGTCAAACCCTCCTTTCACACACGCGCGCACCAAATGAGACGGCACAACTTCTC
TGAGTTTTGACAGGACGGCGAGGAATCCGGGAGCCGACAGCTGGCTGCAGTACCTCTGCTTCGTGGAGGCTGCCCGTGG
CAGGATCTGATCCGTCAGCCCACACGAGAATAAGTGTGCCAAGAAAGGAAAGGAAACTCAACTTAGTTTGAACTGGCTC
TCAAATTTCTCCTCCAGTCTACAAAGGCCAAACAAATATAAGACTCCATCAGCTTTGAAAAGGAACTGAGCACTACAAT
GGGACTCCCTTCCCAGGTTTTGGCCTGTGCCATCTTAGGTTTGCTGTACCAGCATGCCAGTGGTGGGCTCATCAAGCGA
ATTATCCGGCAGAAGCGGGAGACTGGGCTCAATGTGACCTTACCAGAGGATAATCAGCCTGTGGTTTTCAATCATGTCT
ACAACATCAAGCTGCCTGTTGGCTCCCTTTGCTCTGTGGACCTGGACACAGCAAGTGGGGACGCAGACCTGAAGGCAGA
AATTGAGCCTGTCAAGAATTACGAGGAGCATACGGTGAATGAGGGGAACCAGATTGTCTTCACGCACCGCATCAACATT
CCCCGCCGGGCCTGTGGCTGTGCGGCTGCCCCAGACATCAAGGACCTGCTGAGCAGACTGGAGGAGCTGGAGGGGCTGG
TATCCTCCCTCCGGGAGCAGTGTGCCAGCGGGGCTGGATGCTGTCCTAATTCCCAGACAGCAGAAGGTCGCCTGGACAC
GGCCCCCTATTGCAGTGGGCACGGCAACTACAGCACCGAGATCTGTGGCTGCGTGTGCGAGCCAGGCTGGAAAGGCCCC
AACTGCTCCGAACCGGCCTGCCCACGCAACTGCCTCAACCGCGGCCTCTGCGTGCGGGGCAAATGCATCTGCGAGGAGG
GCTTTACCGGCGAGGACTGCAGCCAGGCTGCCTGCCCGTCTGACTGCAACGACCAAGGCAAGTGTGTGGATGGGGTGTG
CGTCTGCTTCGAGGGCTACACGGGCCCGGACTGCGGCGAGGAGCTCTGCCCCCACGGGTGTGGCATTCACGGGCGCTGT
GTGGGTGGACGCTGTGTGTGCCACGAGGGCTTCACTGGCGAGGACTGCAATGAGCCTCTGTGCCCCAACAACTGTCACA
ACCGCGGGCGCTGTGTGGACAACGAGTGCGTCTGCGATGAGGGCTACACGGGAGAGGACTGCGGCGAGCTGATTTGCCC
CAATGACTGCTTTGACCGCGGGCGCTGCATCAATGGGACCTGCTTCTGCGAGGAGGGCTACACTGGAGAGGACTGCGGC
GAGCTGACCTGCCCCAACAACTGCAACGGCAACGGGCGCTGTGAGAACGGGCTGTGTGTGTGCCATGAGGGCTTCGTGG
GGGATGACTGCAGCCAGAAGAGGTGCCCGAAGGACTGCAATAACCGCGGGCGCTGCGTGGATGGGCGCTGTGTGTGCCA
TGAGGGGTACCTGGGGGAGGACTGTGGGGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTCAACGGG
CAGTGTGTGTGTGATGAGGGATTCATTGGGGAGGACTGTGGAGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGC
GCTGCGTCAATGGGCAGTGCGAGTGCCACGAGGGATTCATCGGGGAGGACTGCGGGGAGCTGCGGTGTCCCAACGACTG
CAACAGCCATGGGCGCTGTGTCAATGGGCAGTGCGTGTGTGATGAGGGGTACACAGGGGAGGACTGCGGGGAGTTGCGG
TGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTGGAGGGACGCTGTGTGTGTGACAACGGCTTCATGGGGGAGGACT
GCGGGGAGCTGTCCTGTCCCAATGACTGCCACCAGCACGGGCGCTGCGTCGATGGGCGCTGCGTGTGCCATGAGGACTT
CACTGGGGAAGACTGCCGGGAACGGTCCTGCCCCAATGACTGCAACAACGTGGGCCGCTGTGTCGAGGGACGGTGTGTC
TGTGAGGAAGGTTACATGGGGATCGACTGTTCTGATGTGTCTCCTCCAACAGAGCTGACTGTAACGAATGTAACAGATA
AAACGGTAAATCTGGAATGGAAGCATGAGAATCTCGTCAATGAGTACCTTGTCACCTATGTCCCTACCAGCAGTGGTGG
CTTAGATCTACAGTTCACCGTACCAGGAAACCAGACATCTGCCACTATTCATGAGCTGGAGCCTGGTGTGGAATACTTC
ATCCGTGTCTTTGCAATCCTTAAAAACAAGAAAAGTATTCCAGTCAGTGCCAGAGTAGCGACATATTTGCCTGCTCCAG
AAGGTCTGAAATTCAAATCTGTTAGAGAAACGTCTGTCCAGGTGGAATGGGATCCTCTGAGCATTTCCTTTGATGGCTG
GGAGCTGGTCTTTCGTAATATGCAGAAAAAGGATGATAATGGAGACATAACCAGCAGCTTGAAAAGGCCGGAGACATCA
TATATGCAGCCAGGATTGGCACCAGGACAACAGTATAATGTATCCCTTCATATAGTGAAAAACAATACCAGAGGACCAG
GGCTATCCCGAGTGATAACCACAAAACTCGATGCCCCTAGCCAGATTGAAGCGAAAGATGTCACAGACACCACAGCTCT
GATCACATGGTCCAAACCCTTGGCTGAAATTGAAGGCATAGAGCTCACATATGGCCCCAAGGATGTTCCAGGGGACAGG
ACTACCATTGACCTCTCTGAGGATGAAAACCAATATTCTATTGGAAACCTGAGGCCACACACAGAATATGAAGTGATAC
TCATTTCTCGGCGAGGGGACATGGAGAGTGACCCTGCAAAAGAAGTCTTTGTCACAGACTTGGATGCTCCACGAAACCT
GAAGCGAGTGTCACAGACAGACAACAGCATTACTTTGGAGTGGAAGAACAGCCATGCAAATATTGATAATTACCGAATT
AAGTTTGCTCCCATTTCTGGTGGAGACCACACTGAGCTGACAGTGCCAAAGGGCAACCAAGCAACAACCAGAGCTACAC
TCACAGGTTTGAGACCTGGAACTGAATATGGCATTGGAGTGACAGCAGTGAGACAGGACAGGGAAAGTGCTCCTGCTAC
CATTAATGCTGGCACTGATCTTGATAACCCCAAGGACTTGGAAGTCAGTGACCCCACTGAAACCACCCTGTCCCTTCGC
TGGAGAAGACCAGTGGCCAAATTTGATCGTTACCGCCTCACTTACGTTAGCCCCTCTGGAAAGAAGAACGAAGTGGAGA
TCCCTGTGGACAGTACCTCTTTTATCCTGAGAGGATTAGACGCAGGGACGGAGTACACCATCAGTCTAGTGGCAGAGAA
GGGCAGACACAAAAGCAAACCCACAACCATCAAGGGTTCGACTGAGGAAGAACCTGAGCTTGGAAACTTATCAGTGTCA
GAGACTGGCTGGGATGGTTTCCAGCTCACCTGGACAGCAGCCGACGGGGCCTATGAGAACTTTGTCATTCAGGTGCAGC
AGTCTGACAATCCAGAAGAAACCTGGAACATTACAGTCCCCGGCGTACAGCACTCTGTGAACGTTACAGGCCTCAAGGC
CAACACACCTTATAACGTCACACTTTATGGTGTGATTCGAGGCTACAGAACCAAACCCCTTTATGTTGAAACCACGACA
GGAGCACACCCTGAAGTTGGTGAGCTAACCGTTTCCGACATTACTCCTGAAAGCTTCAACCTTTCTTGGACGACCACCA
GCGGGGACTTTGACGCCTTTACTATTGAAATTATTGATTCTAACAGGTTGCTGGAGCCCATGGAGTTCAACATCTCAGG
CAATTCAAGAACAGCTCATATCTCAGGGCTTTCCCCCAGCACTGATTTTATTGTCTACCTCTATGGGATCTCTCATGGT
TTCCGCACACAGGCAATAAGTGCTGCGGCTACAACAGAGGCAGAACCCGAGGTGGACAACCTTCTGGTTTCAGATGCTA
CCCCTGACGGCTTCCGTCTGTCCTGGACTGCAGATGATGGGGTTTTCGACAGTTTTGTTCTAAAAATCAGGGATACCAA
AAGGAAATCTGATCCACTGGAACTCATAGTACCAGGCCATGAGCGCACCCATGATATAACAGGGCTGAAAGAGGGCACT
GAGTATGAAATTGAGCTCTATGGAGTTAGCAGTGGACGGCGCTCCCAACCCATAAATTCAGTAGCAACCACAGTTGTGG
GATCTCCCAAGGGAATCTCTTTCTCGGACATCACAGAAAACTCTGCTACAGTCAGCTGGACGCCCCCCCGCAGCCGTGT
GGATAGCTACAGGGTCTCCTATGTCCCCATCACAGGCGGCACTCCCAATGTTGTTACAGTTGATGGAAGCAAGACAAGG
ACAAAGCTGGTGAAGTTAGTCCCAGGTGTAGACTACAACGTTAATATCATCTCTGTGAAAGGCTTTGAAGAAAGCGAAC
CCATTTCTGGAATTCTGAAAACAGCTCTGGACAGCCCGTCAGGACTGGTAGTGATGAACATTACAGACTCGGAGGCTCT
GGCAACCTGGCAGCCTGCAATTGCAGCTGTGGATAATTACATTGTCTCCTACTCTTCTGAGGATGAGCCAGAAGTTACA
CAGATGGTATCAGGAAACACAGTGGAGTACGACCTGAATGGCCTTCGACCTGCGACAGAGTACACCCTGAGGGTGCATG
CAGTGAAGGATGCGCAGAAGAGCGAGACCCTCTCCACCCAGTTCACTACAGGACTCGATGCTCCAAAAGATTTAAGTGC
TACCGAGGTTCAGTCAGAAACAGCTGTGATAACGTGGAGGCCTCCACGTGCTCCTGTCACTGATTACCTCCTGACCTAC
GAGTCCATTGATGGCAGAGTCAAGGAAGTCATCCTAGACCCTGAGACGACCTCCTACACCCTGACAGAGCTGAGCCCAT
CCACTCAATACACAGTGAAACTTCAGGCACTGAGCAGATCTATGAGGAGCAAAATGATCCAGACTGTTTTCACCACAAC
TGGTCTTCTTTATCCTTATCCTAAAGACTGCTCCCAAGCTCTCCTGAATGGAGAGGTCACCTCTGGGCTCTACACTATT
TATCTGAATGGAGACAGGACACAGCCTCTGCAAGTCTTCTGTGACATGGCTGAAGATGGAGGTGGATGGATTGTGTTCC
TGAGGCGTCAAAATGGAAAGGAAGATTTCTACAGGAACTGGAAGAATTACGTGGCCGGCTTTGGAGATCCCAAGGATGA
ATTCTGGATAGGTCTGGAGAACCTCCACAAAATCAGCTCTCAGGGGCAGTACGAGCTGCGTGTGGATCTGAGAGACAGA
GGTGAGACAGCCTATGCTGTGTACGACAAGTTCAGCGTTGGAGATGCCAAGACCCGGTACCGGCTGAGGGTGGATGGCT
ACAGTGGCACAGCAGGTGACTCCATGACCTACCATAATGGAAGATCCTTCTCCACTTTTGACAAGGACAATGATTCTGC
TATCACCAACTGTGCTTTGTCATACAAGGGTGCTTTCTGGTACAAGAATTGTCACCGAGTCAATCTGATGGGCAGATAT
GGTGACAACAACCACAGTCAGGGTGTTAATTGGTTCCACTGGAAGGGCCACGAATACTCCATCCAGTTTGCAGAGATGA
AACTGAGACCCTCCAGCTTTCGGAATCTGGAAGGAAGACGAAAGCGAGCATAAAGCCTTGGGATGGTGAAAGGGCTACG
GGCAGGGCAACATGGGGAGGGACAGAGAGCGGGGGGCATGGGAGGATCTCTGGCATCACTGGGGTGATGGGTGTGAGGA
GCTGGTAGTCGTACCAAAGCATCGCAACCCTTGGCACAAGAGCCCAAACAACGAGCCTTACGTGTCCCAGCAATTCCAG
CAGAGCAGCTCCAGCTCTGCCCACTGCTGATGTCCTTCACGCCAAAGACAACGATCTCAAGGGTTGTATGCTGTTTTCT
TCATTTTTCTTTTCTCAGCCTCTGGGATGAAGTTCTTCCACGGTCTGACTATCTCTTGGGTGGCCCAGGGTAGGGGAGG
GAGAACAGCTTTGTATATTGGTAGTTTGTTTTAGAACCAGCCATATTTTTTACACACAGAAATGTGTATGATTAATTAT
CATTATTATTATTATTAGATATAATTGAAATCCTTTGGTTGTTGGAAAGCCTTTTTTTATATATATATCAAGTACCACA
GAGAAGAAGGGGGGGGGGGGGGGGGGAGAGGGAAAGCAGTACATTTTTAAACTTGAGCAAAAAAATTAATATTATTAAT
ATAATGACAAAGTAATAATAATAATGATAATAATAAGCTAAGTTTTTGTCATTTTTAAGAGAACAATGCTTTTGGGAAC
ACAGCAGGACAGTGTCTGATTGTAAATTTCTTTTTTTAAATAAAAGCACAATTACTTTTAAATAAATTTCTACCTTTTT
TTTTTTTTTTTTCATACTTGTTGAGTTGGTGCATGTCCAGGGTATCTGTACGTACATGGGGAAGTAAAAGGCTGAAAAT
GATCAGGCTGCTGAGCCCGTACTGAAAACTGTTCCTTTTGTTAGTGGTTAGCTGTAAGAATTCTGCTGGGTTTCTTGCA
GCGAAAGGTCCTTATGGATTTGATTTCTTTTAGAACACATTTCTTTTCTTTTTCCTGCCCAAAAGCTTTTACACGTTTT
TCTCAGTGTTACTGACCAACGCTTGCTCCATCTAGGTGGGAATAACTAACAAAAGAAAACAAGAAAAGCACAGAGTTGT
TGTTAGGTACCATTGGTGACTTTGAACACTTGTGTAAATAAAGGGCTCTCTTTTTGTATGAATGAAACCTATGTGTAGT
TCCTCTGTATCATGCTCTTCAGTTGGAGACAATAAAAGATCTTTTGTTTTAA
CitationTan SS, Prieto AL, Newgreen DF, Crossin KL, Edelman GM. Cytotactin expression in somites after dorsal neural tube and neural crest ablation in chicken embryos. Proc Natl Acad Sci U S A. 1991 Aug 1;88(15):6398-402.
CopyrightCopyright © 1991 National Academy of Sciences. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205456.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Somites
HH stage 12-
13-18
stage 13
stage 13
stage 18
Dermomyotome
Spinal Ganglia and Nerves
 
19-20
stage 20
stage 20
Dermomyotome
Spinal Ganglia and Nerves
 

Entry 7

GEISHA IdTenascin-C.Singh.2016Data SourcePublication
Complete cDNA Template Probeshow
GGCTGATCTGACCAGTGTGCCGCACTGTCAAACCCTCCTTTCACACACGCGCGCACCAAATGAGACGGCACAACTTCTC
TGAGTTTTGACAGGACGGCGAGGAATCCGGGAGCCGACAGCTGGCTGCAGTACCTCTGCTTCGTGGAGGCTGCCCGTGG
CAGGATCTGATCCGTCAGCCCACACGAGAATAAGTGTGCCAAGAAAGGAAAGGAAACTCAACTTAGTTTGAACTGGCTC
TCAAATTTCTCCTCCAGTCTACAAAGGCCAAACAAATATAAGACTCCATCAGCTTTGAAAAGGAACTGAGCACTACAAT
GGGACTCCCTTCCCAGGTTTTGGCCTGTGCCATCTTAGGTTTGCTGTACCAGCATGCCAGTGGTGGGCTCATCAAGCGA
ATTATCCGGCAGAAGCGGGAGACTGGGCTCAATGTGACCTTACCAGAGGATAATCAGCCTGTGGTTTTCAATCATGTCT
ACAACATCAAGCTGCCTGTTGGCTCCCTTTGCTCTGTGGACCTGGACACAGCAAGTGGGGACGCAGACCTGAAGGCAGA
AATTGAGCCTGTCAAGAATTACGAGGAGCATACGGTGAATGAGGGGAACCAGATTGTCTTCACGCACCGCATCAACATT
CCCCGCCGGGCCTGTGGCTGTGCGGCTGCCCCAGACATCAAGGACCTGCTGAGCAGACTGGAGGAGCTGGAGGGGCTGG
TATCCTCCCTCCGGGAGCAGTGTGCCAGCGGGGCTGGATGCTGTCCTAATTCCCAGACAGCAGAAGGTCGCCTGGACAC
GGCCCCCTATTGCAGTGGGCACGGCAACTACAGCACCGAGATCTGTGGCTGCGTGTGCGAGCCAGGCTGGAAAGGCCCC
AACTGCTCCGAACCGGCCTGCCCACGCAACTGCCTCAACCGCGGCCTCTGCGTGCGGGGCAAATGCATCTGCGAGGAGG
GCTTTACCGGCGAGGACTGCAGCCAGGCTGCCTGCCCGTCTGACTGCAACGACCAAGGCAAGTGTGTGGATGGGGTGTG
CGTCTGCTTCGAGGGCTACACGGGCCCGGACTGCGGCGAGGAGCTCTGCCCCCACGGGTGTGGCATTCACGGGCGCTGT
GTGGGTGGACGCTGTGTGTGCCACGAGGGCTTCACTGGCGAGGACTGCAATGAGCCTCTGTGCCCCAACAACTGTCACA
ACCGCGGGCGCTGTGTGGACAACGAGTGCGTCTGCGATGAGGGCTACACGGGAGAGGACTGCGGCGAGCTGATTTGCCC
CAATGACTGCTTTGACCGCGGGCGCTGCATCAATGGGACCTGCTTCTGCGAGGAGGGCTACACTGGAGAGGACTGCGGC
GAGCTGACCTGCCCCAACAACTGCAACGGCAACGGGCGCTGTGAGAACGGGCTGTGTGTGTGCCATGAGGGCTTCGTGG
GGGATGACTGCAGCCAGAAGAGGTGCCCGAAGGACTGCAATAACCGCGGGCGCTGCGTGGATGGGCGCTGTGTGTGCCA
TGAGGGGTACCTGGGGGAGGACTGTGGGGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTCAACGGG
CAGTGTGTGTGTGATGAGGGATTCATTGGGGAGGACTGTGGAGAGCTGCGGTGCCCCAACGACTGCCACAACCGCGGGC
GCTGCGTCAATGGGCAGTGCGAGTGCCACGAGGGATTCATCGGGGAGGACTGCGGGGAGCTGCGGTGTCCCAACGACTG
CAACAGCCATGGGCGCTGTGTCAATGGGCAGTGCGTGTGTGATGAGGGGTACACAGGGGAGGACTGCGGGGAGTTGCGG
TGCCCCAACGACTGCCACAACCGCGGGCGCTGCGTGGAGGGACGCTGTGTGTGTGACAACGGCTTCATGGGGGAGGACT
GCGGGGAGCTGTCCTGTCCCAATGACTGCCACCAGCACGGGCGCTGCGTCGATGGGCGCTGCGTGTGCCATGAGGACTT
CACTGGGGAAGACTGCCGGGAACGGTCCTGCCCCAATGACTGCAACAACGTGGGCCGCTGTGTCGAGGGACGGTGTGTC
TGTGAGGAAGGTTACATGGGGATCGACTGTTCTGATGTGTCTCCTCCAACAGAGCTGACTGTAACGAATGTAACAGATA
AAACGGTAAATCTGGAATGGAAGCATGAGAATCTCGTCAATGAGTACCTTGTCACCTATGTCCCTACCAGCAGTGGTGG
CTTAGATCTACAGTTCACCGTACCAGGAAACCAGACATCTGCCACTATTCATGAGCTGGAGCCTGGTGTGGAATACTTC
ATCCGTGTCTTTGCAATCCTTAAAAACAAGAAAAGTATTCCAGTCAGTGCCAGAGTAGCGACATATTTGCCTGCTCCAG
AAGGTCTGAAATTCAAATCTGTTAGAGAAACGTCTGTCCAGGTGGAATGGGATCCTCTGAGCATTTCCTTTGATGGCTG
GGAGCTGGTCTTTCGTAATATGCAGAAAAAGGATGATAATGGAGACATAACCAGCAGCTTGAAAAGGCCGGAGACATCA
TATATGCAGCCAGGATTGGCACCAGGACAACAGTATAATGTATCCCTTCATATAGTGAAAAACAATACCAGAGGACCAG
GGCTATCCCGAGTGATAACCACAAAACTCGATGCCCCTAGCCAGATTGAAGCGAAAGATGTCACAGACACCACAGCTCT
GATCACATGGTCCAAACCCTTGGCTGAAATTGAAGGCATAGAGCTCACATATGGCCCCAAGGATGTTCCAGGGGACAGG
ACTACCATTGACCTCTCTGAGGATGAAAACCAATATTCTATTGGAAACCTGAGGCCACACACAGAATATGAAGTGATAC
TCATTTCTCGGCGAGGGGACATGGAGAGTGACCCTGCAAAAGAAGTCTTTGTCACAGACTTGGATGCTCCACGAAACCT
GAAGCGAGTGTCACAGACAGACAACAGCATTACTTTGGAGTGGAAGAACAGCCATGCAAATATTGATAATTACCGAATT
AAGTTTGCTCCCATTTCTGGTGGAGACCACACTGAGCTGACAGTGCCAAAGGGCAACCAAGCAACAACCAGAGCTACAC
TCACAGGTTTGAGACCTGGAACTGAATATGGCATTGGAGTGACAGCAGTGAGACAGGACAGGGAAAGTGCTCCTGCTAC
CATTAATGCTGGCACTGATCTTGATAACCCCAAGGACTTGGAAGTCAGTGACCCCACTGAAACCACCCTGTCCCTTCGC
TGGAGAAGACCAGTGGCCAAATTTGATCGTTACCGCCTCACTTACGTTAGCCCCTCTGGAAAGAAGAACGAAGTGGAGA
TCCCTGTGGACAGTACCTCTTTTATCCTGAGAGGATTAGACGCAGGGACGGAGTACACCATCAGTCTAGTGGCAGAGAA
GGGCAGACACAAAAGCAAACCCACAACCATCAAGGGTTCGACTGAGGAAGAACCTGAGCTTGGAAACTTATCAGTGTCA
GAGACTGGCTGGGATGGTTTCCAGCTCACCTGGACAGCAGCCGACGGGGCCTATGAGAACTTTGTCATTCAGGTGCAGC
AGTCTGACAATCCAGAAGAAACCTGGAACATTACAGTCCCCGGCGTACAGCACTCTGTGAACGTTACAGGCCTCAAGGC
CAACACACCTTATAACGTCACACTTTATGGTGTGATTCGAGGCTACAGAACCAAACCCCTTTATGTTGAAACCACGACA
GGAGCACACCCTGAAGTTGGTGAGCTAACCGTTTCCGACATTACTCCTGAAAGCTTCAACCTTTCTTGGACGACCACCA
GCGGGGACTTTGACGCCTTTACTATTGAAATTATTGATTCTAACAGGTTGCTGGAGCCCATGGAGTTCAACATCTCAGG
CAATTCAAGAACAGCTCATATCTCAGGGCTTTCCCCCAGCACTGATTTTATTGTCTACCTCTATGGGATCTCTCATGGT
TTCCGCACACAGGCAATAAGTGCTGCGGCTACAACAGAGGCAGAACCCGAGGTGGACAACCTTCTGGTTTCAGATGCTA
CCCCTGACGGCTTCCGTCTGTCCTGGACTGCAGATGATGGGGTTTTCGACAGTTTTGTTCTAAAAATCAGGGATACCAA
AAGGAAATCTGATCCACTGGAACTCATAGTACCAGGCCATGAGCGCACCCATGATATAACAGGGCTGAAAGAGGGCACT
GAGTATGAAATTGAGCTCTATGGAGTTAGCAGTGGACGGCGCTCCCAACCCATAAATTCAGTAGCAACCACAGTTGTGG
GATCTCCCAAGGGAATCTCTTTCTCGGACATCACAGAAAACTCTGCTACAGTCAGCTGGACGCCCCCCCGCAGCCGTGT
GGATAGCTACAGGGTCTCCTATGTCCCCATCACAGGCGGCACTCCCAATGTTGTTACAGTTGATGGAAGCAAGACAAGG
ACAAAGCTGGTGAAGTTAGTCCCAGGTGTAGACTACAACGTTAATATCATCTCTGTGAAAGGCTTTGAAGAAAGCGAAC
CCATTTCTGGAATTCTGAAAACAGCTCTGGACAGCCCGTCAGGACTGGTAGTGATGAACATTACAGACTCGGAGGCTCT
GGCAACCTGGCAGCCTGCAATTGCAGCTGTGGATAATTACATTGTCTCCTACTCTTCTGAGGATGAGCCAGAAGTTACA
CAGATGGTATCAGGAAACACAGTGGAGTACGACCTGAATGGCCTTCGACCTGCGACAGAGTACACCCTGAGGGTGCATG
CAGTGAAGGATGCGCAGAAGAGCGAGACCCTCTCCACCCAGTTCACTACAGGACTCGATGCTCCAAAAGATTTAAGTGC
TACCGAGGTTCAGTCAGAAACAGCTGTGATAACGTGGAGGCCTCCACGTGCTCCTGTCACTGATTACCTCCTGACCTAC
GAGTCCATTGATGGCAGAGTCAAGGAAGTCATCCTAGACCCTGAGACGACCTCCTACACCCTGACAGAGCTGAGCCCAT
CCACTCAATACACAGTGAAACTTCAGGCACTGAGCAGATCTATGAGGAGCAAAATGATCCAGACTGTTTTCACCACAAC
TGGTCTTCTTTATCCTTATCCTAAAGACTGCTCCCAAGCTCTCCTGAATGGAGAGGTCACCTCTGGGCTCTACACTATT
TATCTGAATGGAGACAGGACACAGCCTCTGCAAGTCTTCTGTGACATGGCTGAAGATGGAGGTGGATGGATTGTGTTCC
TGAGGCGTCAAAATGGAAAGGAAGATTTCTACAGGAACTGGAAGAATTACGTGGCCGGCTTTGGAGATCCCAAGGATGA
ATTCTGGATAGGTCTGGAGAACCTCCACAAAATCAGCTCTCAGGGGCAGTACGAGCTGCGTGTGGATCTGAGAGACAGA
GGTGAGACAGCCTATGCTGTGTACGACAAGTTCAGCGTTGGAGATGCCAAGACCCGGTACCGGCTGAGGGTGGATGGCT
ACAGTGGCACAGCAGGTGACTCCATGACCTACCATAATGGAAGATCCTTCTCCACTTTTGACAAGGACAATGATTCTGC
TATCACCAACTGTGCTTTGTCATACAAGGGTGCTTTCTGGTACAAGAATTGTCACCGAGTCAATCTGATGGGCAGATAT
GGTGACAACAACCACAGTCAGGGTGTTAATTGGTTCCACTGGAAGGGCCACGAATACTCCATCCAGTTTGCAGAGATGA
AACTGAGACCCTCCAGCTTTCGGAATCTGGAAGGAAGACGAAAGCGAGCATAAAGCCTTGGGATGGTGAAAGGGCTACG
GGCAGGGCAACATGGGGAGGGACAGAGAGCGGGGGGCATGGGAGGATCTCTGGCATCACTGGGGTGATGGGTGTGAGGA
GCTGGTAGTCGTACCAAAGCATCGCAACCCTTGGCACAAGAGCCCAAACAACGAGCCTTACGTGTCCCAGCAATTCCAG
CAGAGCAGCTCCAGCTCTGCCCACTGCTGATGTCCTTCACGCCAAAGACAACGATCTCAAGGGTTGTATGCTGTTTTCT
TCATTTTTCTTTTCTCAGCCTCTGGGATGAAGTTCTTCCACGGTCTGACTATCTCTTGGGTGGCCCAGGGTAGGGGAGG
GAGAACAGCTTTGTATATTGGTAGTTTGTTTTAGAACCAGCCATATTTTTTACACACAGAAATGTGTATGATTAATTAT
CATTATTATTATTATTAGATATAATTGAAATCCTTTGGTTGTTGGAAAGCCTTTTTTTATATATATATCAAGTACCACA
GAGAAGAAGGGGGGGGGGGGGGGGGGGGAGAGGGAAAGCAGTACATTTTTAAACTTGAGCAAAAAAATTAATATTATTA
ATATAATGACAAAGTAATAATAATAATGATAATAATAAGCTAAGTTTTTGTCATTTTTAAGAGAACAATGCTTTTGGGA
ACACAGCAGGACAGTGTCTGATTGTAAATTTCTTTTTTTAAATAAAAGCACAATTACTTTTAAATAAATTTCTACCTTT
TTTTTTTTTTTTTTCATACTTGTTGAGTTGGTGCATGTCCAGGGTATCTGTACGTACATGGGGAAGTAAAAGGCTGAAA
ATGATCAGGCTGCTGAGCCCGTACTGAAAACTGTTCCTTTTGTTAGTGGTTAGCTGTAAGAATTCTGCTGGGTTTCTTG
CAGCGAAAGGTCCTTATGGATTTGATTTCTTTTAGAACACATTTCTTTTCTTTTTCCTGCCCAAAAGCTTTTACACGTT
TTTCTCAGTGTTACTGACCAACGCTTGCTCCATCTAGGTGGGAATAACTAACAAAAGAAAACAAGAAAAGCACAGAGTT
GTTGTTAGGTACCATTGGTGACTTTGAACACTTGTGTAAATAAAGGGCTCTCTTTTTGTATGAATGAAACCTATGTGTA
GTTCCTCTGTATCATGCTCTTCAGTTGGAGACAATAAAAGATCTTTTGTTTTAA
CitationSingh PN, Ray A, Azad K, Bandyopadhyay A. A comprehensive mRNA expression analysis of developing chicken articular cartilage. Gene Expr Patterns. 2016 Jan;20(1):22-31.
CopyrightCopyright © 2015 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205456). Tenascin-C is also known as TNC in NCBI.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 28
Limb Buds
 
31-38
stage 31
stage 34
stage 36
stage 38
Limb Buds
 
all
 
  

Entry 8

GEISHA IdTNC.Smith.2018Data SourcePublication
Complete cDNA Template Probeshow
AGACTGGCTGGGATGGTTTCCAGCTCACCTGGACAGCAGCCGACGGGGCCTATGAGAACTTTGTCATTCAGGTGCAGCA
GTCTGACAATCCAGAAGAAACCTGGAACATTACAGTCCCCGGCGGACAGCACTCTGTGAACGTTACAGGCCTCAAGGCC
AACACACCTTATAACGTCACACTTTACGGTGTGATTCGAGGCTACAGAACCAAACCCCTTTATGTTGAAACCACGACAG
GAGCACACCCCGAAGTTGGTGAGCTAACCGTTTCCGACATTACTCCTGAAAGCTTCAACCTTTCTTGGACGACCACCAA
CGGGGACTTTGACGCCTTTACTATTGAAATTATTGATTCTAACAGGTTGCTGGAGCCCATGGAGTTCAACATCTCAGGC
AATTCAAGAACAGCTCATATCTCAGGGCTTTCCCCCAGCACTGATTTTATTGTCTACCTCTATGGGATCTCTCATGGTT
TCCGCACACAGGCAATAAGTGCTGCGGCTACAACAGAGGCAGAACCCGA
CitationJonathan N Smith, Heather M Walker, Hannah Thompson, J Martin Collinson, Neil Vargesson, Lynda Erskine. Lens-regulated retinoic acid signalling controls expansion of the developing eye. Development. 2018 Oct 10;145(19):dev167171. DOI: 10.1242/dev.167171.
CopyrightCopyright © 2018. Published by The Company of Biologists Ltd.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Smith et al. 2018.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-23
stage 23
Retina
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.51524

Mouse

EmageMGI:101922
EurexpressMGI:101922
MGI GXDMGI:101922

Frog

Xenbase1002815

Fruit Fly

BDGP

Zebra Finch

ZEBrATNC

Zebrafish

ZFINZDB-GENE-980526-104
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona