GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TBX6
T-box 6

Gene
Official SymbolTBX6
Official Full NameT-box 6
CGNC ID4798
also known asCH-TBX6L, Tbx6L, T-box-containing protein TBX6L|T-box containing protein|transcription factor TBX6L, t-box 6
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001030367
PolypeptideNP_001025538
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.466
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish30264ENSDARG00000007329ZDB-GENE-990615-5ZFIN:ZDB-GENE-990615-5
Gene Ontology
Molecular FunctionDNA binding, sequence-specific DNA binding transcription factor activity
Biological Processmulticellular organismal development, transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene395792
Ensembl GeneENSGALG00000006374
KEGGgga:395792

Entry 1

GEISHA IdTbx6.James.2005Data SourcePublication
Complete cDNA Template Probeshow
CTGGATCTCCGATGGAAGGGCTTTTGCATGCTTCAGGACATCAGACCTGCTTTTGAACTGGACTATTTTGGCTCCCTTA
TTGAGAACTCTGGTGGCTCTCTCGGCTGTGCGACCTCCTAGACTCCACATTACATGGAAAAATGCAAGTTTTGCCAGAC
ATTAAAGCGCCATGTGACGCACTTGCTTCCCCCAGCCTGGAGCCCTACCCGCAGAGCTCCATCACGGTCACCCTGGAGG
ACATGGGTCTCTGGATGAAGTTTCATCAGATAGGGACGGAGATGATCATCACCAAATCCGGCAGACGAATGTTTCCACA
ATGCAAAATCAAAGTCTCTGGCTTAATCCCCTATGCCAAGTACCTCATGCTGGTGGATTTTGTGCCTGTGGACAACTTC
AGGTACAAGTGGAATAAAGATCAGTGGGAAGTTGCTGGAAAAGCAGAGCCCCAGCTCCCTTGTCGCACCTATGTCCACC
CCGATTCCCCCGCTCCTGGCAGCCACTGGATGAAGGAACCTGTCTCCTTCCAGAAACTGAAGCTCACCAACAACACTCT
GGATCAACATGGGCATATCATCCTGCACTCCATGCACCGTTACAAGCCTCGCTTCCACATTGTGCAGGCAGATGACCTC
TTCAGTGTTCGCTGGAGTATATTCCAAGTCTTCAGCTTCCCTGAGACTGTCTTCACTTCTGTTACTGCCTACCAGAATG
AGCAGATCACAAAGCTGAAGATTGACAACAATCCATTTGCTAAAGGTTTCCGGGAGCATGGGAAGAACACTCGAAGGGA
AGGACGAGCCAAATCCCAGAAGCCAAGTCCAGCCAAGGGCCAGAAGAGAAAGCTGCCAGAGGAAAAGGAGTCTGGTGCT
GAGGAACGTGATTTTGAGAAAGATGAGAATGTGGATGTGAAGGAAGAGAGTAACCCCATTGTGGTCAGCAGTGGGTACC
CCTTCTGGATCTCAGAGCAGAACAGCAGCCATGCCTTTCCTGCAGCATCGCCGGCGCCAGCCGAACAGAGGGAAGGTCC
AGCCAGAGAGCAGCAAGTGCCTACACCATCCTACCAGACCTACCGGTTCCACGAAGCTGGGGACAGCCAGCAGCTCCCC
AGCCGCGATGTCGCTGCCTTGAACGACTTCCGAGCGAGGTGCCACCCCTTGGATCTCGCCACGGTGCCCGAGCACGACT
CCAAACAGCTCCCAGAGGGCTTCACCAACCTGCCTCCGCTGCCCCCACCTCTGCCCCCTCCCCAGGACTACACTGGAGT
GGTGAACATGGCTCTGGACTCAGTGGGGAAACCTGGAGCTCGAGCGCCCATGTACAGTCCTTATGGCACCGAGCAAGGC
CTTGGGCAGTGGATGGTGCCACCCCACAGCCAGTACAGGGCGATGAGCTACTCGGCCTTCTCCACAGATTACAACACAC
AAGGGGCTTCGGGACATGCCCACGGGACCATGGCAGAGTGGAGCCAGTACCCACTGTTCCCCTATGCCTGCTGGTGAGC
AGGGAGGAACCTTCCCAATGAACAGACTGAAAGAAAATTGTAAATGAGAACAGATTTGTTCTGGGGTGCTAACCTTGAA
GCCTTGTCTATAGTAGGCAAAGAGGCATTGCTGCAGATGGTGGCATGGGACGCCTTCACTTCCTTGTCTCCTTGCACAA
CAACCCTCACGGTATTTCACAAGCAGCAGCCACACTGCTGGCAGTCCCAGCTGTGTCAGGGCACGTCTGGCTCAATCTG
TGTGTTCTGCAGTGCTTCTTCTCCAGCAGGAATAGGAAACCACAGGAACTGTGAGAACTGCAGTGAAAGAGCTGCCGAC
CTCTGTCCCAGTCCATGCTTGCATTTGGCAGCTTCCAAAATCCCTTCTTCCCAGGACACGTGTGCAAGGAGATAGGGGC
TGAGGAGTTTCAGTAAGCCAGGCCAAGAAGCTGTAGAGGATTTTTGCAAGGATGAGCCAGAAAAGCAATTCCAGTGACC
CCTTGAGCAGGTTTCATCACTTAGTATAGTCAAACTAAAATCTTGCCTTCTTTTCCAGGAGCATGTGACAGTAAAACAT
GCAGTGGTACACGCGGCTGTGGATCATGCAGGCAGGGAAGAGCTCGTCTTCTGCACGAGAACCAGCAGCAAGGCTCTGT
GTTGNGTCTGTCCCTCATGCCCACCCCTATCTCATCTCCCC
CitationJames RG, Schultheiss TM. Bmp signaling promotes intermediate mesoderm gene expression in a dose-dependent, cell-autonomous and translation-dependent manner. Dev Biol. 2005 Dec 1;288(1):113-25. Epub 2005 Oct 21.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001030367).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
Somites
 
all
 
  

Entry 2

GEISHA IdTBX6.Hardy.2011Data SourcePublication
Complete cDNA Template Probeshow
CTGGATCTCCGATGGAAGGGCTTTTGCATGCTTCAGGACATCAGACCTGCTTTTGAACTGGACTATTTTGGCTCCCTTA
TTGAGAACTCTGGTGGCTCTCTCGGCTGTGCGACCTCCTAGACTCCACATTACATGGAAAAATGCAAGTTTTGCCAGAC
ATTAAAGCGCCATGTGACGCACTTGCTTCCCCCAGCCTGGAGCCCTACCCGCAGAGCTCCATCACGGTCACCCTGGAGG
ACATGGGTCTCTGGATGAAGTTTCATCAGATAGGGACGGAGATGATCATCACCAAATCCGGCAGACGAATGTTTCCACA
ATGCAAAATCAAAGTCTCTGGCTTAATCCCCTATGCCAAGTACCTCATGCTGGTGGATTTTGTGCCTGTGGACAACTTC
AGGTACAAGTGGAATAAAGATCAGTGGGAAGTTGCTGGAAAAGCAGAGCCCCAGCTCCCTTGTCGCACCTATGTCCACC
CCGATTCCCCCGCTCCTGGCAGCCACTGGATGAAGGAACCTGTCTCCTTCCAGAAACTGAAGCTCACCAACAACACTCT
GGATCAACATGGGCATATCATCCTGCACTCCATGCACCGTTACAAGCCTCGCTTCCACATTGTGCAGGCAGATGACCTC
TTCAGTGTTCGCTGGAGTATATTCCAAGTCTTCAGCTTCCCTGAGACTGTCTTCACTTCTGTTACTGCCTACCAGAATG
AGCAGATCACAAAGCTGAAGATTGACAACAATCCATTTGCTAAAGGTTTCCGGGAGCATGGGAAGAACACTCGAAGGGA
AGGACGAGCCAAATCCCAGAAGCCAAGTCCAGCCAAGGGCCAGAAGAGAAAGCTGCCAGAGGAAAAGGAGTCTGGTGCT
GAGGAACGTGATTTTGAGAAAGATGAGAATGTGGATGTGAAGGAAGAGAGTAACCCCATTGTGGTCAGCAGTGGGTACC
CCTTCTGGATCTCAGAGCAGAACAGCAGCCATGCCTTTCCTGCAGCATCGCCGGCGCCAGCCGAACAGAGGGAAGGTCC
AGCCAGAGAGCAGCAAGTGCCTACACCATCCTACCAGACCTACCGGTTCCACGAAGCTGGGGACAGCCAGCAGCTCCCC
AGCCGCGATGTCGCTGCCTTGAACGACTTCCGAGCGAGGTGCCACCCCTTGGATCTCGCCACGGTGCCCGAGCACGACT
CCAAACAGCTCCCAGAGGGCTTCACCAACCTGCCTCCGCTGCCCCCACCTCTGCCCCCTCCCCAGGACTACACTGGAGT
GGTGAACATGGCTCTGGACTCAGTGGGGAAACCTGGAGCTCGAGCGCCCATGTACAGTCCTTATGGCACCGAGCAAGGC
CTTGGGCAGTGGATGGTGCCACCCCACAGCCAGTACAGGGCGATGAGCTACTCGGCCTTCTCCACAGATTACAACACAC
AAGGGGCTTCGGGACATGCCCACGGGACCATGGCAGAGTGGAGCCAGTACCCACTGTTCCCCTATGCCTGCTGGTGAGC
AGGGAGGAACCTTCCCAATGAACAGACTGAAAGAAAATTGTAAATGAGAACAGATTTGTTCTGGGGTGCTAACCTTGAA
GCCTTGTCTATAGTAGGCAAAGAGGCATTGCTGCAGATGGTGGCATGGGACGCCTTCACTTCCTTGTCTCCTTGCACAA
CAACCCTCACGGTATTTCACAAGCAGCAGCCACACTGCTGGCAGTCCCAGCTGTGTCAGGGCACGTCTGGCTCAATCTG
TGTGTTCTGCAGTGCTTCTTCTCCAGCAGGAATAGGAAACCACAGGAACTGTGAGAACTGCAGTGAAAGAGCTGCCGAC
CTCTGTCCCAGTCCATGCTTGCATTTGGCAGCTTCCAAAATCCCTTCTTCCCAGGACACGTGTGCAAGGAGATAGGGGC
TGAGGAGTTTCAGTAAGCCAGGCCAAGAAGCTGTAGAGGATTTTTGCAAGGATGAGCCAGAAAAGCAATTCCAGTGACC
CCTTGAGCAGGTTTCATCACTTAGTATAGTCAAACTAAAATCTTGCCTTCTTTTCCAGGAGCATGTGACAGTAAAACAT
GCAGTGGTACACGCGGCTGTGGATCATGCAGGCAGGGAAGAGCTCGTCTTCTGCACGAGAACCAGCAGCAAGGCTCTGT
GTTGNGTCTGTCCCTCATGCCCACCCCTATCTCATCTCCCC
CitationHardy KM, Yatskievych TA, Konieczka J, Bobbs AS, Antin PB. FGF signalling through RAS/MAPK and PI3K pathways regulates cell movement and gene expression in the chicken primitive streak without affecting E-cadherin expression. BMC Dev Biol. 2011 Mar 21;11:20.
Copyright© 2011 Hardy et al; licensee BioMed Central Ltd.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_001030367).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Primitive Streak
 

Entry 3

GEISHA IdTBX-6L.Dady.2012Data SourcePublication
Complete cDNA Template Probeshow
CTGGATCTCCGATGGAAGGGCTTTTGCATGCTTCAGGACATCAGACCTGCTTTTGAACTGGACTATTTTGGCTCCCTTA
TTGAGAACTCTGGTGGCTCTCTCGGCTGTGCGACCTCCTAGACTCCACATTACATGGAAAAATGCAAGTTTTGCCAGAC
ATTAAAGCGCCATGTGACGCACTTGCTTCCCCCAGCCTGGAGCCCTACCCGCAGAGCTCCATCACGGTCACCCTGGAGG
ACATGGGTCTCTGGATGAAGTTTCATCAGATAGGGACGGAGATGATCATCACCAAATCCGGCAGACGAATGTTTCCACA
ATGCAAAATCAAAGTCTCTGGCTTAATCCCCTATGCCAAGTACCTCATGCTGGTGGATTTTGTGCCTGTGGACAACTTC
AGGTACAAGTGGAATAAAGATCAGTGGGAAGTTGCTGGAAAAGCAGAGCCCCAGCTCCCTTGTCGCACCTATGTCCACC
CCGATTCCCCCGCTCCTGGCAGCCACTGGATGAAGGAACCTGTCTCCTTCCAGAAACTGAAGCTCACCAACAACACTCT
GGATCAACATGGGCATATCATCCTGCACTCCATGCACCGTTACAAGCCTCGCTTCCACATTGTGCAGGCAGATGACCTC
TTCAGTGTTCGCTGGAGTATATTCCAAGTCTTCAGCTTCCCTGAGACTGTCTTCACTTCTGTTACTGCCTACCAGAATG
AGCAGATCACAAAGCTGAAGATTGACAACAATCCATTTGCTAAAGGTTTCCGGGAGCATGGGAAGAACACTCGAAGGGA
AGGACGAGCCAAATCCCAGAAGCCAAGTCCAGCCAAGGGCCAGAAGAGAAAGCTGCCAGAGGAAAAGGAGTCTGGTGCT
GAGGAACGTGATTTTGAGAAAGATGAGAATGTGGATGTGAAGGAAGAGAGTAACCCCATTGTGGTCAGCAGTGGGTACC
CCTTCTGGATCTCAGAGCAGAACAGCAGCCATGCCTTTCCTGCAGCATCGCCGGCGCCAGCCGAACAGAGGGAAGGTCC
AGCCAGAGAGCAGCAAGTGCCTACACCATCCTACCAGACCTACCGGTTCCACGAAGCTGGGGACAGCCAGCAGCTCCCC
AGCCGCGATGTCGCTGCCTTGAACGACTTCCGAGCGAGGTGCCACCCCTTGGATCTCGCCACGGTGCCCGAGCACGACT
CCAAACAGCTCCCAGAGGGCTTCACCAACCTGCCTCCGCTGCCCCCACCTCTGCCCCCTCCCCAGGACTACACTGGAGT
GGTGAACATGGCTCTGGACTCAGTGGGGAAACCTGGAGCTCGAGCGCCCATGTACAGTCCTTATGGCACCGAGCAAGGC
CTTGGGCAGTGGATGGTGCCACCCCACAGCCAGTACAGGGCGATGAGCTACTCGGCCTTCTCCACAGATTACAACACAC
AAGGGGCTTCGGGACATGCCCACGGGACCATGGCAGAGTGGAGCCAGTACCCACTGTTCCCCTATGCCTGCTGGTGAGC
AGGGAGGAACCTTCCCAATGAACAGACTGAAAGAAAATTGTAAATGAGAACAGATTTGTTCTGGGGTGCTAACCTTGAA
GCCTTGTCTATAGTAGGCAAAGAGGCATTGCTGCAGATGGTGGCATGGGACGCCTTCACTTCCTTGTCTCCTTGCACAA
CAACCCTCACGGTATTTCACAAGCAGCAGCCACACTGCTGGCAGTCCCAGCTGTGTCAGGGCACGTCTGGCTCAATCTG
TGTGTTCTGCAGTGCTTCTTCTCCAGCAGGAATAGGAAACCACAGGAACTGTGAGAACTGCAGTGAAAGAGCTGCCGAC
CTCTGTCCCAGTCCATGCTTGCATTTGGCAGCTTCCAAAATCCCTTCTTCCCAGGACACGTGTGCAAGGAGATAGGGGC
TGAGGAGTTTCAGTAAGCCAGGCCAAGAAGCTGTAGAGGATTTTTGCAAGGATGAGCCAGAAAAGCAATTCCAGTGACC
CCTTGAGCAGGTTTCATCACTTAGTATAGTCAAACTAAAATCTTGCCTTCTTTTCCAGGAGCATGTGACAGTAAAACAT
GCAGTGGTACACGCGGCTGTGGATCATGCAGGCAGGGAAGAGCTCGTCTTCTGCACGAGAACCAGCAGCAAGGCTCTGT
GTTGNGTCTGTCCCTCATGCCCACCCCTATCTCATCTCCCC
CitationDady A, Blavet C, Duband JL Timing and kinetics of E- to N-cadherin switch during neurulation in the avian embryo DEVELOPMENTAL DYNAMICS. Volume 241, Issue 8, August 2012, Pages: 1333–1349.
CopyrightCopyright © 2012 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # AB193180.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-14
stage 14
stage 14
Paraxial Mesoderm
 

Entry 4

GEISHA IdTBX6.Tenin.2010Data SourcePublication
Complete cDNA Template Probeshow
CTGGATCTCCGATGGAAGGGCTTTTGCATGCTTCAGGACATCAGACCTGCTTTTGAACTGGACTATTTTGGCTCCCTTA
TTGAGAACTCTGGTGGCTCTCTCGGCTGTGCGACCTCCTAGACTCCACATTACATGGAAAAATGCAAGTTTTGCCAGAC
ATTAAAGCGCCATGTGACGCACTTGCTTCCCCCAGCCTGGAGCCCTACCCGCAGAGCTCCATCACGGTCACCCTGGAGG
ACATGGGTCTCTGGATGAAGTTTCATCAGATAGGGACGGAGATGATCATCACCAAATCCGGCAGACGAATGTTTCCACA
ATGCAAAATCAAAGTCTCTGGCTTAATCCCCTATGCCAAGTACCTCATGCTGGTGGATTTTGTGCCTGTGGACAACTTC
AGGTACAAGTGGAATAAAGATCAGTGGGAAGTTGCTGGAAAAGCAGAGCCCCAGCTCCCTTGTCGCACCTATGTCCACC
CCGATTCCCCCGCTCCTGGCAGCCACTGGATGAAGGAACCTGTCTCCTTCCAGAAACTGAAGCTCACCAACAACACTCT
GGATCAACATGGGCATATCATCCTGCACTCCATGCACCGTTACAAGCCTCGCTTCCACATTGTGCAGGCAGATGACCTC
TTCAGTGTTCGCTGGAGTATATTCCAAGTCTTCAGCTTCCCTGAGACTGTCTTCACTTCTGTTACTGCCTACCAGAATG
AGCAGATCACAAAGCTGAAGATTGACAACAATCCATTTGCTAAAGGTTTCCGGGAGCATGGGAAGAACACTCGAAGGGA
AGGACGAGCCAAATCCCAGAAGCCAAGTCCAGCCAAGGGCCAGAAGAGAAAGCTGCCAGAGGAAAAGGAGTCTGGTGCT
GAGGAACGTGATTTTGAGAAAGATGAGAATGTGGATGTGAAGGAAGAGAGTAACCCCATTGTGGTCAGCAGTGGGTACC
CCTTCTGGATCTCAGAGCAGAACAGCAGCCATGCCTTTCCTGCAGCATCGCCGGCGCCAGCCGAACAGAGGGAAGGTCC
AGCCAGAGAGCAGCAAGTGCCTACACCATCCTACCAGACCTACCGGTTCCACGAAGCTGGGGACAGCCAGCAGCTCCCC
AGCCGCGATGTCGCTGCCTTGAACGACTTCCGAGCGAGGTGCCACCCCTTGGATCTCGCCACGGTGCCCGAGCACGACT
CCAAACAGCTCCCAGAGGGCTTCACCAACCTGCCTCCGCTGCCCCCACCTCTGCCCCCTCCCCAGGACTACACTGGAGT
GGTGAACATGGCTCTGGACTCAGTGGGGAAACCTGGAGCTCGAGCGCCCATGTACAGTCCTTATGGCACCGAGCAAGGC
CTTGGGCAGTGGATGGTGCCACCCCACAGCCAGTACAGGGCGATGAGCTACTCGGCCTTCTCCACAGATTACAACACAC
AAGGGGCTTCGGGACATGCCCACGGGACCATGGCAGAGTGGAGCCAGTACCCACTGTTCCCCTATGCCTGCTGGTGAGC
AGGGAGGAACCTTCCCAATGAACAGACTGAAAGAAAATTGTAAATGAGAACAGATTTGTTCTGGGGTGCTAACCTTGAA
GCCTTGTCTATAGTAGGCAAAGAGGCATTGCTGCAGATGGTGGCATGGGACGCCTTCACTTCCTTGTCTCCTTGCACAA
CAACCCTCACGGTATTTCACAAGCAGCAGCCACACTGCTGGCAGTCCCAGCTGTGTCAGGGCACGTCTGGCTCAATCTG
TGTGTTCTGCAGTGCTTCTTCTCCAGCAGGAATAGGAAACCACAGGAACTGTGAGAACTGCAGTGAAAGAGCTGCCGAC
CTCTGTCCCAGTCCATGCTTGCATTTGGCAGCTTCCAAAATCCCTTCTTCCCAGGACACGTGTGCAAGGAGATAGGGGC
TGAGGAGTTTCAGTAAGCCAGGCCAAGAAGCTGTAGAGGATTTTTGCAAGGATGAGCCAGAAAAGCAATTCCAGTGACC
CCTTGAGCAGGTTTCATCACTTAGTATAGTCAAACTAAAATCTTGCCTTCTTTTCCAGGAGCATGTGACAGTAAAACAT
GCAGTGGTACACGCGGCTGTGGATCATGCAGGCAGGGAAGAGCTCGTCTTCTGCACGAGAACCAGCAGCAAGGCTCTGT
GTTGNGTCTGTCCCTCATGCCCACCCCTATCTCATCTCCCC
CitationTenin G, Wright D, Ferjentsik Z, Bone R, McGrew MJ, Maroto M. The chick somitogenesis oscillator is arrested before all paraxial mesoderm is segmented into somites. BMC Dev Biol. 2010 Feb 25;10:24.
Copyrightauthors retain copyright of their article, and grant any third party the right to use reproduce and disseminate the article, subject to the terms of BMC Developmental Biology copyright and license agreement
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 22
stage 24
stage 24
Tail
 
25-27
stage 25
stage 26
stage 26
stage 26
stage 27
stage 27
Tail
Unlabeled Embryonic
 

Entry 5

GEISHA IdTBX6L.Acloque.2008Data SourcePublication
Complete cDNA Template Probeshow
CTGGATCTCCGATGGAAGGGCTTTTGCATGCTTCAGGACATCAGACCTGCTTTTGAACTGGACTATTTTGGCTCCCTTA
TTGAGAACTCTGGTGGCTCTCTCGGCTGTGCGACCTCCTAGACTCCACATTACATGGAAAAATGCAAGTTTTGCCAGAC
ATTAAAGCGCCATGTGACGCACTTGCTTCCCCCAGCCTGGAGCCCTACCCGCAGAGCTCCATCACGGTCACCCTGGAGG
ACATGGGTCTCTGGATGAAGTTTCATCAGATAGGGACGGAGATGATCATCACCAAATCCGGCAGACGAATGTTTCCACA
ATGCAAAATCAAAGTCTCTGGCTTAATCCCCTATGCCAAGTACCTCATGCTGGTGGATTTTGTGCCTGTGGACAACTTC
AGGTACAAGTGGAATAAAGATCAGTGGGAAGTTGCTGGAAAAGCAGAGCCCCAGCTCCCTTGTCGCACCTATGTCCACC
CCGATTCCCCCGCTCCTGGCAGCCACTGGATGAAGGAACCTGTCTCCTTCCAGAAACTGAAGCTCACCAACAACACTCT
GGATCAACATGGGCATATCATCCTGCACTCCATGCACCGTTACAAGCCTCGCTTCCACATTGTGCAGGCAGATGACCTC
TTCAGTGTTCGCTGGAGTATATTCCAAGTCTTCAGCTTCCCTGAGACTGTCTTCACTTCTGTTACTGCCTACCAGAATG
AGCAGATCACAAAGCTGAAGATTGACAACAATCCATTTGCTAAAGGTTTCCGGGAGCATGGGAAGAACACTCGAAGGGA
AGGACGAGCCAAATCCCAGAAGCCAAGTCCAGCCAAGGGCCAGAAGAGAAAGCTGCCAGAGGAAAAGGAGTCTGGTGCT
GAGGAACGTGATTTTGAGAAAGATGAGAATGTGGATGTGAAGGAAGAGAGTAACCCCATTGTGGTCAGCAGTGGGTACC
CCTTCTGGATCTCAGAGCAGAACAGCAGCCATGCCTTTCCTGCAGCATCGCCGGCGCCAGCCGAACAGAGGGAAGGTCC
AGCCAGAGAGCAGCAAGTGCCTACACCATCCTACCAGACCTACCGGTTCCACGAAGCTGGGGACAGCCAGCAGCTCCCC
AGCCGCGATGTCGCTGCCTTGAACGACTTCCGAGCGAGGTGCCACCCCTTGGATCTCGCCACGGTGCCCGAGCACGACT
CCAAACAGCTCCCAGAGGGCTTCACCAACCTGCCTCCGCTGCCCCCACCTCTGCCCCCTCCCCAGGACTACACTGGAGT
GGTGAACATGGCTCTGGACTCAGTGGGGAAACCTGGAGCTCGAGCGCCCATGTACAGTCCTTATGGCACCGAGCAAGGC
CTTGGGCAGTGGATGGTGCCACCCCACAGCCAGTACAGGGCGATGAGCTACTCGGCCTTCTCCACAGATTACAACACAC
AAGGGGCTTCGGGACATGCCCACGGGACCATGGCAGAGTGGAGCCAGTACCCACTGTTCCCCTATGCCTGCTGGTGAGC
AGGGAGGAACCTTCCCAATGAACAGACTGAAAGAAAATTGTAAATGAGAACAGATTTGTTCTGGGGTGCTAACCTTGAA
GCCTTGTCTATAGTAGGCAAAGAGGCATTGCTGCAGATGGTGGCATGGGACGCCTTCACTTCCTTGTCTCCTTGCACAA
CAACCCTCACGGTATTTCACAAGCAGCAGCCACACTGCTGGCAGTCCCAGCTGTGTCAGGGCACGTCTGGCTCAATCTG
TGTGTTCTGCAGTGCTTCTTCTCCAGCAGGAATAGGAAACCACAGGAACTGTGAGAACTGCAGTGAAAGAGCTGCCGAC
CTCTGTCCCAGTCCATGCTTGCATTTGGCAGCTTCCAAAATCCCTTCTTCCCAGGACACGTGTGCAAGGAGATAGGGGC
TGAGGAGTTTCAGTAAGCCAGGCCAAGAAGCTGTAGAGGATTTTTGCAAGGATGAGCCAGAAAAGCAATTCCAGTGACC
CCTTGAGCAGGTTTCATCACTTAGTATAGTCAAACTAAAATCTTGCCTTCTTTTCCAGGAGCATGTGACAGTAAAACAT
GCAGTGGTACACGCGGCTGTGGATCATGCAGGCAGGGAAGAGCTCGTCTTCTGCACGAGAACCAGCAGCAAGGCTCTGT
GTTGNGTCTGTCCCTCATGCCCACCCCTATCTCATCTCCCC
CitationAcloque H, Wilkinson DG, Nieto MA. In situ hybridization analysis of chick embryos in whole-mount and tissue sections. Methods Cell Biol. 2008;87:169-85. doi: 10.1016/S0091-679X(08)00209-4.
CopyrightCopyright © 2013 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001030367.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
stage 6
Early Mesoderm
 

Entry 6

GEISHA IdTBX6.Lee.2020Data SourcePublication
Complete cDNA Template Probeshow
CTGGATCTCCGATGGAAGGGCTTTTGCATGCTTCAGGACATCAGACCTGCTTTTGAACTGGACTATTTTGGCTCCCTTA
TTGAGAACTCTGGTGGCTCTCTCGGCTGTGCGACCTCCTAGACTCCACATTACATGGAAAAATGCAAGTTTTGCCAGAC
ATTAAAGCGCCATGTGACGCACTTGCTTCCCCCAGCCTGGAGCCCTACCCGCAGAGCTCCATCACGGTCACCCTGGAGG
ACATGGGTCTCTGGATGAAGTTTCATCAGATAGGGACGGAGATGATCATCACCAAATCCGGCAGACGAATGTTTCCACA
ATGCAAAATCAAAGTCTCTGGCTTAATCCCCTATGCCAAGTACCTCATGCTGGTGGATTTTGTGCCTGTGGACAACTTC
AGGTACAAGTGGAATAAAGATCAGTGGGAAGTTGCTGGAAAAGCAGAGCCCCAGCTCCCTTGTCGCACCTATGTCCACC
CCGATTCCCCCGCTCCTGGCAGCCACTGGATGAAGGAACCTGTCTCCTTCCAGAAACTGAAGCTCACCAACAACACTCT
GGATCAACATGGGCATATCATCCTGCACTCCATGCACCGTTACAAGCCTCGCTTCCACATTGTGCAGGCAGATGACCTC
TTCAGTGTTCGCTGGAGTATATTCCAAGTCTTCAGCTTCCCTGAGACTGTCTTCACTTCTGTTACTGCCTACCAGAATG
AGCAGATCACAAAGCTGAAGATTGACAACAATCCATTTGCTAAAGGTTTCCGGGAGCATGGGAAGAACACTCGAAGGGA
AGGACGAGCCAAATCCCAGAAGCCAAGTCCAGCCAAGGGCCAGAAGAGAAAGCTGCCAGAGGAAAAGGAGTCTGGTGCT
GAGGAACGTGATTTTGAGAAAGATGAGAATGTGGATGTGAAGGAAGAGAGTAACCCCATTGTGGTCAGCAGTGGGTACC
CCTTCTGGATCTCAGAGCAGAACAGCAGCCATGCCTTTCCTGCAGCATCGCCGGCGCCAGCCGAACAGAGGGAAGGTCC
AGCCAGAGAGCAGCAAGTGCCTACACCATCCTACCAGACCTACCGGTTCCACGAAGCTGGGGACAGCCAGCAGCTCCCC
AGCCGCGATGTCGCTGCCTTGAACGACTTCCGAGCGAGGTGCCACCCCTTGGATCTCGCCACGGTGCCCGAGCACGACT
CCAAACAGCTCCCAGAGGGCTTCACCAACCTGCCTCCGCTGCCCCCACCTCTGCCCCCTCCCCAGGACTACACTGGAGT
GGTGAACATGGCTCTGGACTCAGTGGGGAAACCTGGAGCTCGAGCGCCCATGTACAGTCCTTATGGCACCGAGCAAGGC
CTTGGGCAGTGGATGGTGCCACCCCACAGCCAGTACAGGGCGATGAGCTACTCGGCCTTCTCCACAGATTACAACACAC
AAGGGGCTTCGGGACATGCCCACGGGACCATGGCAGAGTGGAGCCAGTACCCACTGTTCCCCTATGCCTGCTGGTGAGC
AGGGAGGAACCTTCCCAATGAACAGACTGAAAGAAAATTGTAAATGAGAACAGATTTGTTCTGGGGTGCTAACCTTGAA
GCCTTGTCTATAGTAGGCAAAGAGGCATTGCTGCAGATGGTGGCATGGGACGCCTTCACTTCCTTGTCTCCTTGCACAA
CAACCCTCACGGTATTTCACAAGCAGCAGCCACACTGCTGGCAGTCCCAGCTGTGTCAGGGCACGTCTGGCTCAATCTG
TGTGTTCTGCAGTGCTTCTTCTCCAGCAGGAATAGGAAACCACAGGAACTGTGAGAACTGCAGTGAAAGAGCTGCCGAC
CTCTGTCCCAGTCCATGCTTGCATTTGGCAGCTTCCAAAATCCCTTCTTCCCAGGACACGTGTGCAAGGAGATAGGGGC
TGAGGAGTTTCAGTAAGCCAGGCCAAGAAGCTGTAGAGGATTTTTGCAAGGATGAGCCAGAAAAGCAATTCCAGTGACC
CCTTGAGCAGGTTTCATCACTTAGTATAGTCAAACTAAAATCTTGCCTTCTTTTCCAGGAGCATGTGACAGTAAAACAT
GCAGTGGTACACGCGGCTGTGGATCATGCAGGCAGGGAAGAGCTCGTCTTCTGCACGAGAACCAGCAGCAAGGCTCTGT
GTTGNGTCTGTCCCTCATGCCCACCCCTATCTCATCTCCCC
CitationHyung Chul Lee, Hui-Chun Lu, Mark Turmaine, Nidia M. M. Oliveira, Youwen Yang† , Irene De Almeida and Claudio D. Stern. Molecular anatomy of the pre-primitive streak chick embryo Open Biol. null. 10.1098/rsob.190299.
CopyrightCopyright © 2020 The Authors.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_001030367.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage X
stage XII
stage XII
stage XII
stage XIV
Area Opaca
Epiblast
Kohler's Sickle
Stage EGK X-XI
Stage EGK XII-XIII
Stage EGK XIV-HH2
posterior marginal zone
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.466

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-990615-5
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona