GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HNF1B
HNF1 homeobox B

Gene
Official SymbolHNF1B
Official Full NameHNF1 homeobox B
CGNC ID4099
also known ashepatocyte nuclear factor 1-beta
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003642414
PolypeptideXP_003642462
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene427838
Ensembl Gene
KEGGgga:427838
GEISHA IdVHNF1.Aragon.2009Data SourcePublication
Complete cDNA Template Probeshow
CCCACCAACAAGAAGATGCGTCGCAACCGGTTCAAGTGGGGGCCCGCGTCCCAGCAAATCTTGTACCAGGCCTACGACC
GGCAAAAGAACCCCAGCAAGGAAGAGAGGGAGGCCTTAGTGGAGGAGTGCAACAGGGCAGAATGTTTGCAGCGAGGCGT
CTCCCCCTCCAAAGCCCACGGCCTGGGCTCCAACCTGGTCACTGAGGTCCGCGTCTACAACTGGTTCGCAAACCGCAGG
AAGGAGGAGGCGTTCCGGCAGAAGCTGGCCATGGACGCCTACAGCTCCAGCCAGACGCACGGCCTGAACACCCTGCTCT
CCCACGGATCCCCCCACCACCAACCCAGCACCTCCCCTCCAAACAAGCTGCCAGGAGTGCGCTACAGCCAGCAGGGAAG
CAATGAGGTCACTTCCTCCTCAACAATCAGTCACCATGGCAACAGCGCCATGGTGACTAGCCAGTCGGTTTTACAGCAA
GTCTCTCCAGCCAGCCTGGACCCGGGCCACAATCTCCTCTCACCTGATGGTAAAATGATCTCAGTCTCGGGAGGAGGTT
TGCCCCCTGTCAGCACCTTGACGAATATCCACAGCCTGTCCCACCACAATCCCCAGCAATCTCAAAACCTCATCATGAC
CCCCCTCTCTGGAGTCATGGCCATCGCACAAAG
CitationFerran Aragon, Cristina Pujades. FGF signaling controls caudal hindbrain specification through Ras-ERK1/2 pathway. BMC Dev Biol. 2009; 9: 61.
CopyrightCopyright ©2009 Aragon and Pujades; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 8
stage 10
stage 10
Anterior Intestinal Portal
Hindbrain
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona