GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

WT1
Wilms tumor 1

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolWT1
Official Full NameWilms tumor 1
CGNC ID9187
also known asCWT1, Chick Wilm's tumour protein, Wilms tumor 1 , wt1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205216
PolypeptideNP_990547
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.42868
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human7490ENSG00000184937MIM:194080MIM:607102
Mouse22431ENSMUSG00000016458All phenotypic alleles (17):Targeted, knock-out(6) Targeted, other(11) MGI:98968
Xenopus100216184, 373588, 378664484998
Zebrafish30245, 568416ENSDARG00000031420, ENSDARG00000007990ZDB-GENE-980526-558, ZDB-GENE-050420-319ZFIN:ZDB-GENE-980526-558, ZFIN:ZDB-GENE-050420-319
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene396139
Ensembl Gene
KEGGgga:396139

Entry 1

GEISHA IdWT1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerAGAGCCAGCAAGCCATTCG
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGTTTGGTGCCGTTTCAGTTGGcDNA Template Length663
Forward cDNA Template Probeshow
GAAGAAAAANCTTCGTTCACAGTCCTTAAAATCACACTGGATATGNGTTTTTCACCAGCTGCTGCTTTCTGCTGGTGCA
TCTGTAGATGGGACAGCTTGAAGTATCGCATTGCTTGCAGCCGGGGTAGGCACACATGAAGGGGCGTTTTTCATTTGTC
TCACTTGCTGATCGGACAATAGTCGGAGCTACTCCTGGCACTCGTCGGACATCTTGTATGCCTCTAAAGACTCCATGGG
TGTGTATTCTGTATTGGGCCCCACAGCTGTATAACATGGGAGCACTGTGGTTCTCATTTTCATATCCTGTCGTATGGCC
CTTCAGCGTGGATCCCAGGTTCATTTGGTTCCATGTCATGCATTCCAGCTGTGACGTCATTTGGTACAAATTGTCACTG
TTGTAGGGGGTCCGCAGGAGCAGGACCTGGCTGCCCGTGCAGCTGTCCGTGGGGGTGTGACAGCCGTACACCGGAGGGG
GCACCGAGTACTGCTGGTCCCCTAGAGATGGCTGCTGGCTCATGGGGTCTTCGTGTTTGAAAGAGTGGTTCGTAAACTG
CGCGGCGTGGTGAGACGGCGTGTGGCCGTAGCTCGGAGTCCCGTCAAAGGCCACGGTGCCGTAACCCTGGTTGCNAATG
GCTGNCNTGGCTCTAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Early Mesoderm
Epiblast
Extraembryonic Mesoderm
Primitive Streak
 
7-12
stage 8
stage 9
stage 11
stage 11
stage 11
stage 11
Extraembryonic Mesoderm
Forebrain
Foregut
Intermediate Mesoderm
Neural Plate/Tube
Notochord
Sinus Venosus
 
13-18
stage 13
stage 13
stage 13
stage 15
stage 15
stage 15
stage 15
stage 15
Intermediate Mesoderm
Neural Plate/Tube
Proepicardium
Somatic Mesoderm
 
19-23
stage 20
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 23
stage 23
Allantois
Ear/Otic Placode
Eye
Forebrain
Foregut
Gut
Heart
Hindbrain
Lung
Mesonephros
Midbrain
Nasal Placode/Nerve
Nephric Ducts
Notochord
Proepicardium
Sclerotome
 

Entry 2

GEISHA IdWt1.Schlueter.2006Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ATGGGGTCCGACGTCCGGGACCTGAACGCGCTGCTGCCCTCCGTGCCCTCCCTACCGGGCAACAGCAACTGCGCCATGC
CGGTGAGCAGCGCGGCGCAGTGGGCTCCCGTCCTGGACTTCCCCCCGGGGGCCTCCTACGGCTCGCTGGGGCCGCACTC
CTTCATCAAGCAGGAACCCAGCTGGAACGGGTCGGACCCGCACGAGGAGCAGTACCTGAGCGCTTTCACCGTCCACTTC
TCCGGGCAGTTCACGGGCACGGCCGGGGCCTGCCGCTACGGGCCCTTCGGCGCCCCGCCGCCCAGCCAGCCGCCCTCCG
GCCAGGCCAGGATGTTCCCCCAACGGCCCTACCTGCCCAACTGCCTGGAGAGCCAGCAAGCCATTCGCAACCAGGGTTA
CGGCACCGTGGCCTTTGACGGGACTCCGAGCTACGGCCACACGCCGTCTCACCACGCCGCGCAGTTTCAGAACCACTCT
TTCAAACACGAAGACCCCATGAGCCAGCAGCCATCTCTAGGGGACCAGCAGTACTCGGTGCCCCCTCCGGTGTACGGCT
GTCACACCCCCACGGACACGTGCACGGGCAGCCAGGCCCTGCTCCTGCGGACCCCCTACAACAGTGACAATTTGTACCA
AATGACGTCACGACTGGAATGCATGACATGGAACCAAATGAACCTGGGATCCACGCTGAAGGGCCATACGACAGGATAT
GAAAATGAGAACCACAGTGCTCCCATGTTATACAGCTGTGGGGCCCAATACAGAATACACACCCATGGAGTCTTTAGAG
GCATACAAGATGTCCGACGAGTGCCAGGAGTAGCTCCGACTATTGTCCGATCAGCAAGTGAGACAAATGAAAAACGCCC
CTTCATGTGTGCCTACCCCGGCTGCAACAAGCGATACTTCAAGCTGTCCCATCTACAGATGCACAGCAGAAAGCACACT
GGTGAAAAACCATATCAGTGTGATTTTAAGGACTGTGAACGAAGATTTTCTCGTTCAGACCAACTGAAACGGCACCAAA
GACGACACACAGGTGTGAAACCCTTCCAATGTAAAACCTGTCAGAGAAAGTTCTCCAGATCTGATCATCTGAAGACTCA
TACCAGGACTCATACAGGTAAAACAAGTGAAAAGCCTTTCAGTTGCCGATGGCCCAGCTGTCAAAAAAAATTTGCCAGG
TCTGATGAATTAGTCCGTCACCACAACATGCACCAGAGGAACATGACCAAACTCCAGCTGGCCCTTTAG
CommentsAccording to the authors, "A 1.3 kb Wt1 cDNA probe was kindly provided by T. Kudo, Ibaraki, Japan." As insufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #NM 205216).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 13
stage 13
stage 13
stage 13
stage 15
stage 15
Intermediate Mesoderm
Proepicardium
 
19-22
stage 22
stage 22
stage 22
stage 22
Atria
Ectoderm
Proepicardium
Sinus Venosus
epicardial and pericardial mesothelium

Entry 3

GEISHA IdWt1.Ishii.2007Data SourcePublication
Complete cDNA Template Probeshow
ACAATTTGTACCAAATGACGTCACGACTGGAATGCATGACATGGAACCAAATGAACCTGGGATCCACGCTGAAGGGCCA
TACGACAGGATATGAAAATGAGAACCACAGTGCTCCCATGTTATACAGCTGTGGGGCCCAATACAGAATACACACCCAT
GGAGTCTTTAGAGGCATACAAGATGTCCGACGAGTGCCAGGAGTAGCTCCGACTATTGTCCGATCAGCAAGTGAGACAA
ATGAAAAACGCCCCTTCATGTGTGCCTACCCCGGCTGCAACAAGCGATACTTCAAGCTGTCCCATC
CitationIshii Y, Langberg JD, Hurtado R, Lee S, Mikawa T. Induction of proepicardial marker gene expression by the liver bud. Development. 2007 Oct;134(20):3627-37. Epub 2007 Sep 12.
CopyrightPublished by The Company of Biologists 2007. This material is protected by a copyright retained by the authors. Permission granted by T. Mikawa.
CommentsSequence below was obtained from NCBI (NM_205216) using the primers given in the publication: chick Wt1 (cWt1) forward primer, 5'-ACAATTTGTACCAAATGACGTCACAA-3' and reverse primer 5'-GATGGGACAGCTTGAAGTATCG-3'.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 16
stage 16
stage 18
Intermediate Mesoderm
Proepicardium
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.42868

Mouse

EmageMGI:98968
EurexpressMGI:98968
MGI GXDMGI:98968

Frog

Xenbase484998

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-558, ZDB-GENE-050420-319
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona