GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ZIC3
Zic family member 3

Gene
Official SymbolZIC3
Official Full NameZic family member 3
CGNC ID51676
also known aszinc finger protein ZIC 3|Zic family member 3 heterotaxy 1 (odd-paired homolog, Drosophila)|zinc finger protein Zic3
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_420237
PolypeptideXP_420237
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.206
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene422251
Ensembl GeneENSGALG00000006497
KEGGgga:422251

Entry 1

GEISHA IdZIC3.McMahon.2010Data SourcePublication
Complete cDNA Template Probeshow
CAGCAAGGACTCCACGAAAACGCCGCCGGCAGCCCTGCAAGGGAACCCCGGCCACAACCCCGGCCTGCCCCCCAATTTT
AACGAGTGGTACGTGTGAAGGCAGCGGCTGCCCGGCCAGAGACTGGACCAAACGCCTTGGGAACGAGGCAGAAAGGACA
AGCCAAGCCCACTGCAGCTCGCCCCCACGGAAATGGAGTTTCCACACCGACGACCGCATAGGGCTAGTTAACTGCCAGG
AGCCGGAGGGGGGTGGGGGTGGGGGGGCATCATTTATTATTATATTATAATTATTACTATTTTTTGCAAGCCGAGACGC
TGGACTAGCCATGTCCTTTTCTCAGGATTGGATTTCTTTTGTTTTTCTTTTTCTTTTTCTTTTTCTTTTTTCTTTTCTT
TTTTTTTGCAGTCGTTCCTTTGATTTATTCTTTCCCCTCTCCCTGCCCAGTACCTCTTCCTCCGATTTCCCCCCACTTT
TTACTTTTAATTTTGTTTTGGTTTTCTTCTTCTTTCGGTGGGATGTTGACATGAGGATGAAAATTCTCCTTCGCCTTAG
TGGTGATTGTTTAAACTTACAGTCTTAAACCGTGCCAAAGTCCTGTTATGTCTTGAACTTTCCTCTCTAGCTCTCCTGC
TGCTTCTCTCTCTGCTCTCCTCCTCTTTCTCCTTCTCTCTCTCTCTCTCCAAACATTACACTTGTGAATGTATTCTCAT
CTGATGGGGTCGGTCAGTATTTTTCAGGATGAGGATGTGGTGTTTATTCTACCCAGATTGTGACGTTTAG
CitationMcMahon AR, Merzdorf CS. Expression of the zic1, zic2, zic3, and zic4 genes in early chick embryos. BMC Res Notes. 2010; 3: 167.
CopyrightCopyright ©2010 McMahon et al; licensee BioMed Central Ltd.
CommentsThe probe was amplified by PCR using the following primers: 5'-CAGCAAGGACTCCACGAAAAC-3' and 5'-CTAATACGACTCACTATAGGCGACCCCATCAGATGAGAAT-3' and was extracted from NCBI Acc# XM_420237.3.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 7
stage 8
stage 9
stage 10
stage 11
Forebrain
Hindbrain
Mesencephalon
Midbrain
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Rhombomeres
Somites
HH stage 8+
13-18
stage 13
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 14
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
Dermomyotome
Eye
Forebrain
Hindbrain
Intermediate Mesoderm
Mesencephalon
Metencephalon
Midbrain
Myelencephalon
Neural Plate/Tube
Paraxial Mesoderm
Somites
Spinal Cord
Surface Ectoderm
Tail
Anterior trunk
Mid-trunk
Posterior Trunk

Entry 2

GEISHA IdZIC3.Warner.2003Data SourcePublication
Complete cDNA Template Probeshow
ACGAATGGTACGTCTGAGGACAAACACAAACCCTGTTAATTATAGAATGGACCAAATACATTTTTAAAAGAAAACTGAG
ACCAATCAGATGGAAATGGAGTTTTAAGGCAAGAGGCCATATATAGGGCTACATCTTGTTAATTGCAATTGTCCAGGAA
GGTTTTGGGCAAGATCCAAAAGTAGCCATGCCCTTTTCTCAGGATAGAAAATATGTTTTGGCATTTGAAGCATTTTTTA
CAAAATCTTTACACTACTTTTTCTTCCCCTTCCTCTTGCTCTCTGCACACCCCATTCTTAAACTCCTCCAATTCATTTT
AACACTTGTCCTGTTTCTTGAGAGGAAGTTATAGAAGGCTTGTTGGTGGTGGTGATGTTAAACTGATGGAAATTCTTTT
TCGCCTTAGTGGTGATTGTTTAAACTCTCACAGTCTTAAACCGTGCCAAAGTCCTGTTATGTCTTGAACTTTTCCTCAA
AGCATTACACTTGTGAA
CitationWarner SJ, Hutson MR, Oh SH, Gerlach-Bank LM, Lomax MI, Barald KF. Expression of ZIC genes in the development of the chick inner ear and nervous system. Dev Dyn. 2003 Apr;226(4):702-12.
CopyrightCopyright © 2003 Wiley‐Liss, Inc.
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Warner et al. 2003.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
Ectoderm
Surface Ectoderm
dorsal epithelium
31-44
stage 44
  

Entry 3

GEISHA IdZic3.Odaka.2018Data SourcePublication
Complete cDNA Template Probeshow
GTACTTTTTTGGGGGCGGGCGGGAGGGAGGGAGGAGGGGCGGGGGGGCCAGGCTGCCGCCGCCGCGCCGCCGGCCCCGC
GCCCATGACGATGCTGCTGGACGGAGGGCCGCAGTTCCCGGCGCTGGGGGTGGGCGGCTTCGCGGCGCCCCGCCACCAC
GAGATGCCGGGCCGCGACCCCGCCGCCGGGATGGGACTGGGCCCCTTCGGGGACTCCTCGCACGCCGCCGCCGCCTTCA
AGCTGAACGCGGCCCCGCACGACCTCGCCGCCGGGCAGAGCTCCGCGTTCACCCCCCAGGCTCCCGGCTACGCCAGCGC
GCTCGGCCACCACCACCACCACCACCACCACCACGCCGGCCAGGTGCCCTCGTACGGCGGGGCCGCCGCCTTCAACTCC
ACCCGCGACTTTCTGTTCCGCAACCGCGGCTCCGGGATCGCGGACGCGGGCTCCGGCACGGCTCAGCACGGCCTTTTCG
GCGGCTCTCCCGGAGGTTTGCACGGCCCCGGCGGCATCCCGGACAGCCCGGGCTACCTGCTCTTCCCCGGGCTCCACGA
GCAGAGCCCGAGCCACACGTCCCCCGGCGGGCACGTGGACAACGGGCAGATGCACCTGGGGCTGCGCGGGGACCTCTTC
GGGCGGCCGGATCCGTACCGCGCCGTCTCCAGCCCCCGCACGGACCCTTACGGCGGGGCCCAGTTCCACAACTACAACC
ACATGAACATGAATATGGGCGTGAACGTGGCCGCTCATCACCACCACCACCATCACCACCACGGGCCCGGGGCTTTCTT
TCGGTACATGCGGCAGCCCATCAAGCAAGAGCTGTCCTGCAAGTGGCTCGACGAGAGCCATCTCAGCCGGCCCAAGAAG
AGCTGCGACAGGACTTTCAGCACCATGCACGAGTTGGTCACCCACGTCACCATGGAGCACGTCGGGGGTCCGGAGCAGA
ACAACCACATCTGCTACTGGGACGAGTGCCCGCGGGAAGGCAAATCCTTCAAGGCGAAATACAAACTGGTCAACCACAT
TCGGGTGCACACGGGGGAGAAGCCCTTCCCCTGCCCCTTCCCCGGCTGCGGGAAGATCTTTGCCCGCTCCGAGAACCTC
AAGATCCACAAGCGGACGCACACAGGTGAGAAGCCCTTCAAGTGCGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACA
GCAGCGACAGGAAGAAACACATGCACGTCCACACCTCGGACAAGCCCTACATCTGCAAGGTGTGCGACAAATCCTACAC
CCACCCCAGCTCGCTTAGGAAACACATGAAGGTGCACGAATCCCAGGGCTCGGACTCTTCCCCTGCAGCCAGTTCAGGC
TATGAGTCCTCCACCCCCCCGGCGGTGGGCTCGGCCGGCAGCAAGGACTCCACGAAAACGCCGCCGGCAGCCCTGCAAG
GGAACCCCGGCCACAACCCCGGCCTGCCCCCCAATTTTAACGAGTGGTACGTGTGAAGGCAGCGGCTGCCCGGCCAGAG
ACTGGACCAAACGCCTTGGGAACGAGGCAGAAAGGACAAGCCAAGCCCACTGCAGCTCGCCCCCACGGAAATGGAGTTT
CCACACCGACGACCGCATAGGGCTAGTTAACTGCCAGGAGCCGGAGGGGGGTGGGGGTGGGGGGGCATCATTTATTATT
ATATTATAATTATTACTATTTTTTGCAAGCCGAGACGCTGGACTAGCCATGTCCTTTTCTCAGGATTGGATTTCTTTTG
TTTTTCTTTTTCTTTTTCTTTTTCTTTTTTCTTTTCTTTTTTTTTGCAGTCGTTCCTTTGATTTATTCTTTCCCCTCTC
CCTGCCCAGTACCTCTTCCTCCGATTTCCCCCCACTTTTTACTTTTAATTTTGTTTTGGTTTTCTTCTTCTTTCGGTGG
GATGTTGACATGAGGATGAAAATTCTCCTTCGCCTTAGTGGTGATTGTTTAAACTTACAGTCTTAAACCGTGCCAAAGT
CCTGTTATGTCTTGAACTTTCCTCTCTAGCTCTCCTGCTGCTTCTCTCTCTGCTCTCCTCCTCTTTCTCCTTCTCTCTC
TCTCTCTCCAAACATTACACTTGTGAATGTATTCTCATCTGATGGGGTCGGTCAGTATTTTTCAGGATGAGGATGTGGT
GTTTATTCTACCCAGATTGTGACGTTTAGTATAACAGTTGCCTTTTTGTAATAACTTTTTTTGTAAATACATATCCATG
ATGCCATATTTATCGTTCGTAATTTAATTATTGATACAAAGTGCCGGGAACTGAACAATATTTATGGGGGAGAAAAAAA
TTGTTTTCTAACAAAAAAAAAAAAATACAAACAGCAACAACAACAAAAAAAAATCAACTCTGTACAGCTTTTGGCTATA
ACTGCTTTAGCATTAAAAGTTTATTGTTTTGGAAAGAGCCCCCGAGAGCCGTTTTTGACCTCCTTCGTGTCCCCTCCCC
CTCCCTTTTCGGGGGCCGTCGTGGGCCGGTTCGGGTCCGCGCCGTTGTTTTGGGGCCGGCGATGCGGGAGAAGCGTCCC
GCTCCTCGCTGCCGCTTTTTCTCCTGCCTTTTTGTCCCCGCCCTCCGCTTCGCATCCCTTCCCGAGCCGACGGAGCCCG
GAGCGCGGCGGCGCCGACGGAGAGGAGCCCCGGGGGCAGCGGGGCCGCCCGACGGTGAGTACGGGGCCGGGAGCCGGCA
GAGGGCTGCTTCCCGGAGGGGGACACGGGAGACTTCGAGGCGCGCCGGACTTAGTCCGTTATCGTCTGCTTTTGTTGTT
TTGTTTTCGTTTTGCTTTTTTCTTTATTTCCGATCAGGATTCGACAAAGCGTCCCCATCCCCAGGAGAGCTGAGCCGGG
GAACTCCAACGCCGCCGAGGAGCCTCAAACAACCGAAGCGACGGTGGAAAACCTCTCCTCTCAAAGTTTCGTGCTCCGC
TCCGGGAGACGCCCAGCACCGCACGGGCTGCGGCGGGACGAGGCGGCTCCGTGTCCCGGCGGTGCGCGGCCGCTGCTCC
CCCCGGTGCCGCAGTCGCATCGTCCTCGGAGCTCTCTGCGGGTGGGGACCCCCCGGGCCGCGCACCTCCGCCGTCCGGG
AGCGGCCCCCCCCGACGGGTCCGTCTTGAACTTGACTCGGGGACGCCGCGAGCTGCCGGGGCTGTCCCGTCTCCTCTCG
CATGATGCTCGGGCGAGCGGCCCACGGGATACTGAATACTTTAAAAATTAACCTTCAGCGAATTTCTGATCTCTCCGCA
TCCTCCCCCCTCCCCGAAAAAAAAAAAAAAGAAAGAAAAAAAAGTTAAAAAAAAAAAAAAAGTCTTTTATCTGGCAGGA
AAAGAAAGGAGAAAGATAGACAGCAGTGTCCGGTGCTGCACGTCTGAAAAACAAAACAAACAAACAAACAAAAATCCCA
AGCCCGGTAAAGGCAGCTTTTCCACCTACACTCATTGCTGATTTTTTTCCCCTTAAAACAGTTGCAGGGTTCCCCCCGA
GGTGCCCGGCCAGCCGTGCTCCCGCTGCTCGATGCCGTGTGAGCCCTCGTTGTGCGTGGAGCTCCGGAGCCGCGCCGGG
CCAGGAGGAGCAGAGCCGCCTGGGGCCGTCGGGTTTCCCTCGGACGCCCACCTGTGTCGTGTCTGCTTCAGCCTCAGAA
AGGTGCCGGCGGGCAAAGGAGCAAAGGAGCAGGAACTGTGCCTTGAAGATTCTCCCTGCGCCTTCAGGAGGATGCTGGG
CTGAGCCAAAATCAAAGCGCTCTGCTGTGCTCGCGCTGTGCTGCTGAGGAGTTGGTTTCAGAGGAGTTCCCTCAGCCGG
TCAGAGATCTCAGGTTGGAGATTTATTTTCTTGCTAAAGGGGGGGAAAAATGTAATTAAAAGACCTGAGTAACGCTCAG
TTCCTTTATAAAAATTACAAGCAGACGTGGGGCATTGTGAGAATGGTGATGTTGATAAAAAGACTTGGTGGGCTGTGTG
GAAACCCACATGTGAGTGGTTTCAGCAAGACCCCACCTGTGTCCCTGGCTGTGATTTCTGTTAGCTTTGCTTTGCATTC
GCACTCTCTTTGTATGTTTACTATACCAGCATCAACCGTGTCAGCTGTATGGTGATGTCTGTAATCAGAGGACAGAGCA
AAACAGAGTGTGCTCACATCTGGGTCTGTTAAGAGCCACACTCTCAGCGTCTGTGGCACTCAAACAGCTTTTTAGACAT
TTCTAACACAAACTTGGGCACCCGCAGTATGAAAGCAAGGTTTGTTCTTGTCGTTCATCTTTCATCCCAGCTAGGTGAA
AAAATAGTCTTGATTAGAATAGTTTGCGTCAGTGCTGTGGTTTTGTCACGCTTCTACTTCATTGTTTTACCATAGCTTA
AGAAAGAGTTTCTTTCCAGGCTGACAATAAATTACTGTGAAAGAAAGAAGTCAGCGTCAGTGCCCCCTACAAAGCTCCC
AATCACGGAGGCATCAGCAAAACGTGGATGTTCTGAAAACGTTTTCTTCTTTTCAGTAATATTCTGTTCTTAATCTTGG
GCAGCCTTGTGCATATAAGCTCGTCGTCAGTGCGAGTAAATCGTGCCCAGCAGTAGGGCGGGCACAAGGAAGGGGGCAT
AGGAGAAATACTGCATTTCATAAACACAATCACCAGAGCATTAGGAGAGCAAACATGTGGTTTTATGAACATAGTTATA
AATATTTAAACATGCAAAATGAAAACGTTGCTAAATGTCTGCTTTTCATTATCTTCCAATGAACGTTTTCGTTCTTGGA
AGCCTTGTTGGCTGTCTGCAGAAAGCGATCACCACCCCCTCCCCAAAATGAATGATGCGTAATGCGAAAACGTGTTAAA
ATGCACAGTTGTTTGTAATATCTTCTACCAAAGTGGAAGGCATTCTACCAAATTTGGTATTCTATTGAATCCCAGAGTA
TCCTTGCCCCACAAACAGGAACCAGCCTGCTTCTGTCAGCAACTTTCTTGCTGGATGTTAGGAAAAATCTGAGGGCAGC
TTTGGAAATAGATGCCGCTTAGTGCACTTGGAGACGTGTCCTGTGATCCTTCTCCTTCCTACAGAAGTCAACGAAAGAT
GCCACAGCTGATTTTACCATCATGAATACGTTGCTTTGAAAATTCAGCAAGTGTTCAAGCATTTCCCATGCCTCCATGG
AAGGGTTTGGAGGCTGCAGGGGGAATTTCATGCTGGGGAGCCGTGGTTCTGCCCCTGGATGGGCTGTTGCAGGGGTGTG
AGTCTGCGCCTTTAAATAGGAGCATGGCAAGCCGCAGCAGTATGGGTTGTGCAATTTTGCTTGCGTGAGTGGAGGCCTG
TGAAAGAGCTGGGGCCACGCTGTGCATCACTGTTCGTAATAAGGCAGGTGTCTGGATCCTGGGATCCTGCTCTCTTGGC
TTCAGTCCTGCCCAGTTGTTATATTCCCGCAATGCTCTGGCTGGGCCGTGTATGTCACGGGAGAAGATGCCGATTTTAT
TTATTTATTTGTTTTCTAAACGCACCGGGAAACCCGTTTTCTATTAGTTCCATATTTAATCCTGGGCGCCGTGAGTTTC
TGCTGTGCTGGGCAGAACACGGCATGCCGCGCTGGCACGCACACACGTGCCTGCTGCTCGCTGCGTGTTCCTCCTGCAG
TTGCTCCCACCAATAAATCCGCACTTGCTGCAGTCAGAATGGAAATCTTAAAGACAAAGGATTCGACTGGGCAGTTTTT
ATTGCTGTGATAGAGCAGAAGGCCTCAAATTAGGGGACGGTGCCTGCGTGGATGCCGTCTCCTGCCAGCACTGCGCCGG
TACCAAGGACTGTAAAGGGTTTCTTACTACTGTGCTGCAGCAAATCCCAAAGAAATGGTGGATGAGAAGTGAACATGGA
GGAGCATGGGGCCCCTGCCCTGTGCAAAGCTGCCCTGGCACAGCTTGCAGGGCCATGGCCGGCTGCAGTGCGTGGGCAC
AGCCGGTCCCGTTCCCATGCCGGGGCTGTGGGATGGAGCCTGCTGGCAACCCCAACCCAGGGCTGGTTTCTGGGGGCAG
GCGTGGTGGGGCTGCTCCCTGTGTGCTTACGTCAATGCAGACCTTTCCACGGACTCCAGTCTGGGTTGGATCAAGCCTT
GCATGGTTGTGGCCCTTGTGCATTTCAAAACTGTATTAATCTATATCTGGATCCCAATGGGGCACTCGGGATGAGCTGA
GCTCAAACAATCCTTGGCAGGAGGGACAGAGTGGAGTTGGCGGGGATTTTTGTCCTGTTATTGGTTACTTGGGGGAAGG
AATGTATGCACCAGTTTAATATATGACAACTTGAGGTCTGTCATCTTAAGCATATTAGAAAAGCCTCATTTTTAACAAA
TCCCAGAGCGTTCGGCAGGCATCGTGCTGCAGCTGCACTGGGACCAGGCAATGGCTGTGGATGGAGGCATGGGGCTGCT
TGCTGTCTCAGTGCATGGTTGGGACAGCTCTGAGGCTGCTGGGGGATGGACCCTGGGCCGCTCACCCCTTGGTTGGGGG
ATGGATGGGGAGACAAAAGTCCTGGGGCAGAGAAAAGCTGGCAAATGAGACAGCATCAGTGCAACCCATAGAGCCCATG
CACTAAAAGCTTTTCCTGTCTGGTTCAATGCATCCCCAGTGAATTTGGCCAGGGAGTTACATACTGAGCTCAGAGGAGA
CTTTCTTCTCTATGGTAAAATCTTCAAAAAACTTCCTAAAGACCTTGAGATAGATTTTACACTCTGTATCAGTGTGATA
TTTCCTCCAGTGAAAATAAGGATTGATGCTTCTGTTGGAAATGGTCTTGTATAAATTCATCCTTTCTGCTTTTCCTCTC
TGGATTTCTAAAGTATGAAAAATTCAACCTAGTAAAGACTTTTCAGCAAGTTTATTTGGGTTTGTTGCATCAAGCACAA
GAAATTCAGTCCAGGTAGCTGTTTTACCCTAACATGGTTAGGAAGGAAGGAGGAAATTTATTCTGTTGTATTTCGCTTT
GGTTCGGGGGTGGGGAGGAGTTTGGAAAACAGCTTTCTCTATTTTTACCAAGCATTATTTTCATTTTTCTCAATCGACG
CAGCACCCAAGCTCTTAGCAAGCTGCTGCCTTCAACAACATCCCCATAAGGAGCAAACTGAAACAGCACAAGGAGTAGA
TGTCAGCCTCAGACTGACAACTGCGCTTCTGGGTAATCTAATGCCATTTTAATATCTTGCTTTTAATTCAGCTCAGCGA
ATGCTTTGATGGACACGGCACTGATGCTCGTGAGCCCGAGTTCAGTTGTTAGTGCCATGTCAGAAATTATTTTTCACAG
ACGACTGTAGCTGGAGCGTCAGCTCCCATTAAGTGTATTAAGTGTATTGGTATATATTAAGTATATATGACCTCTGAGA
TTCTGGGCTAGCACGCTGCATTTTGTAGCCTTTGGTTTGTTCCTGCGGTGACAAGAACAGAAGGTCTCTGGTTAACTTT
TGACCATTGACATATTAAATGAAGATGCGCGTTTGAGCAACATCAGTGATTTCAATTGACTCATCAATTGCCATTGCAT
AGCAGTCTTCATGTTTCACTTTGGTAACAAGCTGATCTGCCACATCTGATGCCAGCAATTCAGTCCTTCAAACAAATGA
CATGTTTGATAAAGAAATCTTTTTAAATTCATTATGCACTTTGGCTTTTGTCTTTCCTTTTAATACAGCATCTGTTGCA
GCCGGGATGCATTCCTTGATCGTTTCTGAGTCTGCCATTATTTTTCTGCCTGCCCAGTGTCCCAGGGACGTGAAACGAA
GCCGCTGCGCTTTGCTGCCGAGCACTGAAACTCTGCACCAACATTCAATTTGATCTCTCGGAACTGACTGCAATAAAGT
GGTTTCGTCAGCACACACTTGTGATAAAAAGGCGACACGAAGAAAGCCAGCGAGCTGAAAGGCCCTGCGTTTTCCTGGG
AAGACAATAGGATATCTGGCTCTTTATTTGTTTCGTGGATTCCTTGTGCAGCCATTTAAATTCAGCCGAAGGCTCCAAA
TGTCTAAACTTTATCCTGGGCATTTTATTTATTTTTTTTTCAGTGCTGGAAAGGAATAGAGTTAAGTGTCCCAAGGGGA
GTTTTATAGAAAATGCTATGTGCAATGTTAATGAGTTGGGAAGGGGTCGTATGTTTTTTCATATAGAGCCTATGCAGGA
ACAAATATGGAACCGGAGGAGAAACCATCTGCAGGGACCCAGTGAGGTGTGCCAGCGGGTGATCCTGGGCTGCTGTCAC
CCCTAAATGATGAACAAAAGACTTCAATCCCAAGAGCCCCCCGTGCCCCTGCATGGCTCTGTGCTGGGCTGGGTGAATA
GCCGGGGCTGGAAGAAATGACAAACTTCTTGGGTGCCACAAGAGATTGCTTCAGCGTTACTGATCCTCACTCTGCTCGT
TACTGAAAATGCATCCAGCAGCTATATGGGTCAGACTGCTAAATTTGTAGACACGGAGTGTCAGGAAGCCTTTTTGTCA
ACTTCGTACCGTTTAGTATATTTGTCCTCAAGTTCAAAGCAATCCTGGCCCCAGACTTGTGATATTTTCTGCCCTTTCC
CCTTTCTGTTGACTCAGGCCTCTTCCCTTTGAGGTCAACATCAAAATAAAGATGTATGTTTCCTCAGCCTGACCATGGC
TCTGAGTCTTTAGATCAGCAATCCTATAGTCCATATGTCTTCCCATCTGTCAGCCAGCATTTGAAGCCAGCTTGCTCCT
CTATTCTTTCAGACAAGTGTGAGAATCAGAAGTTTCTTTAATGACGGTTTCAGGCCTTAAAGCATTTGCTAAGATATTA
CCTATTAAGATCCCTTGATGGCACCTTGAATAGAGATCAAAAGCAGCTGAGTTCACTCCGTAAATCTCATCTGGCCTTC
AGTTTAGGGTGCTGGGAGAGGGGTGGGGAGGGCACCGTGTTCCCGTGCTGAGAAGCCCAGCCTGGGAAGTCAGCATTGC
ATTTGTGAAACAGTGACCCAGAGCGTGGCTCTCAGTCTGTCTCTCAAACGTTTCTATTTTTAATGCCTGCCAAGAGCTA
CTGCAAAGCCCTCGGGGTATTTGGGGAAGTGTGTGCTCTTTGGGTTCATATCATTTCATTGGGTTACAGTGGATTTAGC
GGGGAGGCATTCATTGAAGTTTCTGTATGTTGAAAGGTGTGCACGCTGTCATGGGCAGAATGGTGGAGGGCATTCCCAG
AGAACCTCCCAGACGGTGCTAACAAACAGGCTGGCTGTTTATGGGACCCAAATGTCTGTGGGGATCTGAACATCCCCAA
GACGTGGCTGAGCAACGGGGGATGATGTCACAGCACTGCCTGTCCAGTAAAATGTGACACACTGGAGTCAAGCACAACA
TATGGCCCTGGGTTTGTGTTGAAACCTGTTAAAGCGTGAGCATGAACCCGAGCTCCAGAGAGATCCTCTTTGGCCTCAG
TGTCATTAGTCTTCAGCCAGAATATAGCTTGTGCTCCCTGAGAAAAGCAGCTTCTCTGGCTGCCTGCTCTGTAGTGTCG
CTGCTTTTGGAGGAGGTGCTCAATCAAAATGTGGGGCACGCAGATTGTTTGCTTCCAAGAGGGGAAACAGAAGGGACCT
CGATGTAATTTTACATCTTAACCAAGAGGATGCACCAGCTCCTGGACACCGCACCGAGCAAAATGTCCAGCTACTTTTT
GTTCCCAAAGCCTCTTTCAGCCAGCCCCTGCCCCAGAGTACTCTATTTGACATTGTCACTGGGTTTATTTAAGATGGAT
TTGGCTTTTTTTTTTTGCTATTTTTCTGTGCTTATAATCCTTTTAATTCCACCATTTTTCTTTTACGACCTTCGTTCAG
TCTTTTCTGTCCCTCTTTTACGTGGTACTCAGCCAAGTCTGTCTCATTGCTGTCATTTTTAGTGTGAATCCGTATCTGC
CTTTTTAGGGGGTAGTGGCACTGGTGACGTATACTTGTGGTTAAAGCAAAAGCCACTATTGAGTTGGACAAAATAGGAT
GAATGCTGTATAAAAAGCCTTCGGAGAGCTGTGAAATCTCCATCCTCTCTTCCTTGTTCTCCTGGGAACACTTGCACAA
AGAGTATTTTTAATGTGAAGCAAAAAGGATCCTGATGAATACTCATTAACATTTTGTTTCTGCGGAGATACATACATGA
TCATCACAAGGCTGTGAGGGACATGTATTCGGGAAAGCTCTTAGATGTACAATTATTGCTGTGTGCGTGTTTAAATCTT
CCCAATGGCTGCTGCTTTGCTGAACAGACATATTAACCAAAAACAAAAACAGGTATTTAATGGAGCTTGTTTGTCCTGC
CTTGGCCAGAGGCAGTATGCTGCGATAAAGGTCTTCAAACTCAACCCATAGCGGTGCTCTGTGAGCAGTGGATCCTCCC
AGAATGGAATGGGTTGGTTGAAATACACGCCTGCAAATAATTTGTATCGTAGTTGTTAACAACAACGAGAGCAGAATTT
AACCAGAGATTGCAAGGGGAAGCAACATCAGAGCCACCAGATACATTCCATAACATGTTTTCCTCATGTGACTTTGGAC
TCAGCCCAGATAGACACCATTGGGTGAAGGTATCGCTTCACCATTGCCACTTTGGAAGCACCAGTCTCAGAAATGCAGA
TCTGATACGGACTGAAGCCTTTATGCTACTGGCTGTATCCCACCTATTCTGAGCCGGTTAGAAAAAGAGCCTTGGTCAG
AAAGAGTTAATTTAGCATTGAGTCTCAACTAAAAACCTTCTCTGAGAGGCATGTGCCTGACTGTGCCCCTTCCTGCAGA
TATACCACTGATAACCTTCTTCTGTTGCTCTGAATGCCCTGGAGTGCTGGGCTGGCTTCACTGTGTGTGCAGGTCGTGC
CCAGCAGTGTGAGAGGTCCCTAGGTTAGATCAGGAGTGGGGAGCTCCCATTTGCACAAAAGGGAAACTCTCCTGGTGGG
ACCAGCTGTGCAGCAGAGGTAACCAGACGTGACAGTGGAGTTTCCAGGCTTTGCTGGAGTTCTCATACCCTATCACAAG
GCAAACTGGGCACTGATTTTTCATGAGGTCCCTTCTCTTCCAGTGACTGTAACCCAATCTGTGTTGTAATCTGTGCTGT
TCTTTCCGTATGAAATCTTGCAGGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
CitationYuri S Odaka, Takahide Tohmonda, Atsushi Toyoda, Jun Aruga. An Evolutionarily Conserved Mesodermal Enhancer in Vertebrate Zic3. Sci Rep. 2018 Oct 8;8(1):14954. DOI: 10.1038/s41598-018-33235-y.
CopyrightCopyright © The Author(s) 2018.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Odaka et al. 2018.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Headfold
Neural Plate/Tube
Primitive Streak
 
7-11
stage 7
stage 7
stage 7
stage 7
stage 8
stage 9
stage 11
stage 11
stage 11
stage 11
stage 11
Diencephalon
Hindbrain
Mesencephalon
Neural Crest
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Somites
Spinal Cord
Telencephalon
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.206

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona