GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PKDCCB
protein kinase domain containing, cytoplasmic b

Gene
Official SymbolPKDCCB
Official Full Nameprotein kinase domain containing, cytoplasmic b
CGNC ID
also known asPKDCC, protein kinase domain-containing protein, cytoplasmic|extracellular tyrosine-protein kinase PKDCC|protein kinase domain containing, cytoplasmic homolog|protein kinase domain-containing protein, cytoplasmic like 1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_421361
PolypeptideXP_421361
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human91461ENSG00000162878MIM:614150
Mouse106522ENSMUSG00000024247All phenotypic alleles (3):Targeted, knock-out(2) Targeted, other(1) MGI:2147077
Xenopus100216132, 1000370225993400
Zebrafish565254ENSDARG00000038235ZDB-GENE-130530-599ZFIN:ZDB-GENE-130530-599
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene423451
Ensembl GeneENSGALG00000011166
KEGGgga:423451
GEISHA IdcADTK1.Bento.2011Data SourcePublication
Complete cDNA Template Probeshow
CCGAGGAGCTGTCGTGTGAGGAGGATAATGACTGCACACTCGACTTCCCCACAAAAAGCTTTCCTCTCCAGTGCTCTTC
GGCTGGGAAGTGCGAAGGAATAAACGAGAAGAGGAATCTCTTCAACGCGTATCGGTATTTTTTCACCTATCTTCTGCCA
CACTCTGCACCACCAGCTTTGCAGCCCTTTTTGAGTGATATTCTCAATGCAACAGGTAACTTACGGTATGGAATAAATG
AAACCCTGAGAGCTTTTGAAAAGGTTTTACATCTGTACAAGTCTGGGCTCTATCTACAGAAAAGACCTCTTCTTTTAAA
AGACTACATCTTCCTGAGGGGCTTCCGGATGGAGGAAGCAGAGGCCTACAAGTGCTGGCCTTCCTACAGCCACCTGGGC
TGCCTGCTGTCTGTCCACAGCCCCGAGGAGGCCGCTGCCATTTGTAGTTCCCAGCCACAGTGTCAGAGTTTCATCATCA
CCCAGCAGAGAACGTGGACGGGACGCCCACTCGCCTCATTTCAGAGCAGCCCAACTGATTTAATACCGGATACTACTGC
TGTTCTGCATAAACAATCTCAGTTTTAGTTAAATGTGGCCAGGCACTGCAATACCTTGCCTTGCTGCTTCAGTAGTCAG
CTTGTCAGCCAAGAAATAGCAATAGCTGCAGGGACCTGGCTGGAGTAAGCCCAGTTTGCTCAGCAGACTCCGCATAACT
TAGAAATAACACACGCTGGAGAAGGCAGCAGCTCCTCCTGCAGCTGCCAACAAGGGTTTCACACCACTGCAGATGGAAG
GGCTTGGACCTCAGTGGGGGGGTGCAGGCTGGGGTCCGTATCCAGAGGTTGAAGCTGGGGATGGCCTTCTGAGGAGGGT
CGTGGTTCAGCTCCTTTGGGTCAGAGAAGGGAAGGCGGCATGGAGGTCAGCTCTGGAACCCGGTGCCAGAATGCTTGGA
TGTAGGATTTGGGTTTGAGCGGGTGTGATTTGCAATGCCAGCTCCCATGTATCAACCTTGAAGGTTTTTTCTGTTACTT
TCCGTGAAAGAGCGAGACGTTCAAATTATTTATGTACCAGGTGTTACTCTGTGTGGTAAAGAATGTTTATTCT
CitationBento M, Correia E, Tavares AT, Becker JD, Belo JA. Identification of differentially expressed genes in the heart precursor cells of the chick embryo. Gene Expr Patterns. 2011 Oct;11(7):437-47.
CopyrightCopyright © 2011 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # ChEST884h13). Also known as: PKDCC, PKDCCB
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Early Endoderm
Early Mesoderm
Mesoderm
Neural Plate/Tube
hf, heart fields
7-12
stage 7
stage 8
stage 9
stage 9
stage 10
Amnion
Endoderm
Heart
Lateral Plate Mesoderm
Sinus Venosus
hp, heart primordium
pa, pro-amnion
13-14
stage 14
Heart
Lateral Plate Mesoderm
Tail
 
all
 
  

Mouse

Emage
EurexpressMGI:2147077
MGI GXDMGI:2147077

Frog

Xenbase5993400

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-130530-599
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona