GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

DNMT3A
DNA methyltransferase 3 alpha

Gene
Official SymbolDNMT3A
Official Full NameDNA methyltransferase 3 alpha
CGNC ID51587
also known asDNA (cytosine-5)-methyltransferase 3A|DNA (cytosine-5-)-methyltransferase 3 alpha|DNA (cytosine-5-)-methyltransferase 3 alpha transcript variant X1|DNA (cytosine-5-)-methyltransferase 3 alpha transcript variant X2|DNA methyltransferase 3A
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001024832
PolypeptideNP_001020003
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.6002
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1788ENSG00000119772MIM:602769
Mouse13435ENSMUSG00000020661All phenotypic alleles (9):Targeted, knock-out(3) Targeted, other(6) MGI:1261827
Xenopus100496503959528
Zebrafish553189, 553187ENSDARG00000015566, ENSDARG00000005394ZDB-GENE-050314-3, ZDB-GENE-050314-5ZFIN:ZDB-GENE-050314-3, ZFIN:ZDB-GENE-050314-5
Gene Ontology
Molecular FunctionDNA binding, DNA (cytosine-5-)-methyltransferase activity, metal ion binding
Biological ProcessC-5 methylation of cytosine, chromatin modification, DNA methylation, more...regulation of transcription, DNA-templated, transcription, DNA-templated
Cellular Componentcytoplasm, euchromatin, nuclear matrix, nucleus
Links to other databases
Entrez Gene421991
Ensembl GeneENSGALG00000003993
KEGGgga:421991

Entry 1

GEISHA IdcDNMT3A.Rengaraj.2011Data SourcePublication
Complete cDNA Template Probeshow
GCAAGCAGCAGAGCAGGGAAGATCTTCCCGGCGTGCCCCGAGAACGACGAGACTGACACCTCCAAGGTGGTGGAGATCC
AGAACAAGCAGATGATCGAGTGGGCGCTGGGCGGCTTCCAGCCCTCCGGCCCCAAGGGCCTGGAGCCCCCCGAGGAGGA
GCGCAACCCCTACAAAGAAGTTTACACAGAGATGTGGGTCGAGCCAGAAGCCGCTGCCTACGCGCCACCCCCACCCGCC
AAAAAACCCCGGAAAAGCACAACAGAGAAACCCAAGGTCAAGGAGATCATCGATGAGCGCACCCGAGAGCGACTGGTCT
ACGAGGTGCGGCAGAAATGCAGAAACATCGAAGATATCTGCATCTCCTGTGGGAGCCTCAACGTCACCCTGGAGCACCC
TTTGTTTATCGGGGGAATGTGCCAAAACTGCAAGAACTGCTTTCTGGAGTGCGCGTACCAATACGATGACGACGGATAC
CAGTCCTACTGCACCATCTGCTGTGGTGGGCGCGAGGTGCTCATGTGCGGCAACAACAACTGCTGCAGGTGTTTCTGTG
TGGAGTGCGTGGACCTGTTGGTGG
CitationRengaraj D, Lee BR, Lee SI, Seo HW, Han JY. Expression Patterns and miRNA Regulation of DNA Methyltransferases in Chicken Primordial Germ Cells. PLoS One. 2011; 6(5): e19524.
CopyrightCopyright Rengaraj et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
CommentsThe probe was amplified by PCR using the following primers: 5';-GCAAGCAGCAGAGCAGGGAA-3'; and 5';-CCACCAACAGGTCCACGCA-3'; and was extracted from NCBI Acc# NM_001024832.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
Unlabeled
EG&K stage X
4-6
stage 6
Widespread Expression
 
7-12
stage 12
stage 12
Widespread Expression
 
19-24
stage 24
Unlabeled
 
25-30
stage 29
stage 29
stage 29
Ovary
Testis
Unlabeled
 
31-44
stage 35
stage 35
stage 36
stage 36
stage 38
stage 38
stage 40
stage 40
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
Ovary
Testis
Unlabeled
HH stage 36+
HH stage 38+
HH stage 40+
Hatched 1 day
Hatched 12 weeks
Hatched 25 weeks

Entry 2

GEISHA IdDNMT3A.Hu.2012Data SourcePublication
Complete cDNA Template Probeshow
GGCGGTCGGGCGAGCAGGAAGCGCCGTGGGGACACTGCAGCAGCACCGGGAGGAGACGGCCCCGTAAGGGCTCCGGGGT
CCGCGTGCCCACCCGCGGGGGATGCGCCATGGTGGAAAGCAGTGACACACCCAAAGACACGGCGGCCGTCCCCAAGTGC
CCCCCTCCCTGCCCAGAGGCCAGCCCTGCCGAGCCACTGCCCAACGGGGACCTGGAGGCGGACGGAGCCCAGTGGAAGG
GCACGGAGGAGGGCGGCGCGAGCCCCAAAAGCGGGCGCCCCGAGGAGGACGAGACGGAGAGCCTGGCGGATGGCGAGAC
GGGCCGGGCGCTGGAGAACGGCCGCTGCACCCCCAAGGAGGGCCTGGACGCCCCGGCCGATGAGGGTGAGCTGGCCCCT
TCCGACCCCCAGAAGAAACGCGGGAGGAGGAAACTCCTGGAGGCCACAGAGAAAAGCAAGGAGGAGAAGGAGGAAAACA
ACTTCGACAGCCTGAAAATGGAGGGCTCCCGTGGGCGGCTGCGGGGCGGGCTGGGCTGGGAGTCGAGCCTGCGGCAGCG
CCCCATGCAGCGGCACACCTTCCAGGCAGGGGACCCATACTACATCAGCAAGAGGAAGCGCGACGAGTGGCTGGCACGC
TGGAAGAGAGAGGCGGAGAAGAAGGCAAAAGTGATCGCCGTGATGAACGTGGTGGAGGAGACGCCGCGGGCCGAGCCGC
AGAAGGAGGAGGAGGCCAGCCCCCCTGCCTCACAGCAGCCCACCGACCCTGCCTCGCCCAACGTGGCCACCACGCCTGA
GCCTGTGGTGGCCGACGCCGTCGACAAGAACACATCCAAGTCAGCCGACGACGAGCCTGAGTACGAGGACGGTCGGGGC
CTCGGCATCGGCGAGCTGGTGTGGGGCAAGCTGCGTGGCTTCTCCTGGTGGCCGGGGCGCATCGTGTCCTGGTGGATGA
CGGGACGCAGCCGGGCAGCCGAGGGCACCCGCTGGGTGATGTGGTTCGGGGACGGCAAGTTCTCAGTGGTCTGCGTGGA
GAAGCTCCTGCCCCTCAGCTCCTTCTCCAGCGCCTTCCACCAGGCCACCTACAACAAGCAGCCCATGTACCGCAAAGCC
ATCTACGAGGTGCTGCAGGTGGCAAGCAGCAGAGCAGGGAAGATCTTCCCGGCGTGCCCCGAGAACGACGAGACTGACA
CCTCCAAGGTGGTGGAGATCCAGAACAAGCAGATGATCGAGTGGGCGCTGGGCGGCTTCCAGCCCTCCGGCCCCAAGGG
CCTGGAGCCCCCCGAGGAGGAGCGCAACCCCTACAAAGAAGTTTACACAGAGATGTGGGTCGAGCCAGAAGCCGCTGCC
TACGCGCCACCCCCACCCGCCAAAAAACCCCGGAAAAGCACAACAGAGAAACCCAAGGTCAAGGAGATCATCGATGAGC
GCACCCGAGAGCGACTGGTCTACGAGGTGCGGCAGAAATGCAGAAACATCGAAGATATCTGCATCTCCTGTGGGAGCCT
CAACGTCACCCTGGAGCACCCTTTGTTTATCGGGGGAATGTGCCAAAACTGCAAGAACTGCTTTCTGGAGTGCGCGTAC
CAATACGATGACGACGGATACCAGTCCTACTGCACCATCTGCTGTGGTGGGCGCGAGGTGCTCATGTGCGGCAACAACA
ACTGCTGCAGGTGTTTCTGTGTGGAGTGCGTGGACCTGTTGGTGGGGCCGGGGGCTGCACAGGCAGCCATCAAGGAGGA
CCCCTGGAACTGTTACATGTGCGGCCATAAGGGTGTCTATGGGCTCCTGCGGCGGCGCGAAGATTGGCCGTCGCGCCTC
CAGATGTTCTTCGCCAACAACCACGACCAGGAGTTTGATCCGCCGAAGGTGTACCCGCCTGTCCCTGCTGAAAAGAGGA
AGCCCATCCGTGTGCTGTCGCTGTTTGATGGCATCGCCACCGGCCTGCTGGTGCTGAAAGACCTGGGCATCCAGGTGGA
CCGCTACATCGCCTCCGAGGTGTGCGAGGACTCTATCACTGTGGGCATGGTGAGGCACCAGGGCAAGATCATGTATGTT
GGCGACGTCCGAAATGTCACCCAGAAACACATACAGGAGTGGGGCCCCTTCGACCTGGTCATCGGGGGCAGCCCCTGCA
ACGACCTCTCTATAGTGAACCCAGCCAGGAAGGGGCTGTACGAGGGCACTGGGCGCCTCTTCTTTGAGTTCTACCGNCT
NCTGCATGAAGCACGGCCCAAGGAGGGTGACGACCGACCCTTCTTCTGGCTCTTTGAGAACGTGGTGGCCATGGGGGTG
AGCGACAAAAGGGACATCTCACGCTTCCTCGAGTCCAACCCCGTCATGATTGATGCCAAAGAGGTGTCTGCGGCACACC
GGGCACGGTACTTCTGGGGTAACCTTCCCGGTATGAACAGGCCGCTGGCGTCCACGGTCAATGACAAGCTGGAACTCCA
GGAGTGCCTGGAGCACGGCAGGATAGCCAAGTTCAGCAAAGTGAGAACCATCACCACTCGCTCCAACTCCATCAAGCAG
GGCAAAGACCAGCACTTCCCCGTCTTCATGAACGAGAAGGAAGACATCCTGTGGTGCACGGAGATGGAGAGGGTGTTTG
GCTTCCCGGTGCACTACACGGACGTGTCCAACATGAGCCGCCTGGCCCGGCAGAGACTGCTCGGCAGATCCTGGAGCGT
GCCGGTGATCCGCCACCTCTTTGCGCCCCTCAAGGAGTACTTCGCCTGCGTTTAGGAGAGCCGGACGGGGACTGTGCCA
CGGAGCGCGTCGGAACCGAACCATCCATGCCAAGAGAAGAGAAAACGCGGAGCGAGAGAAGAGCCAGCACCCAGCAGAG
AGACGGGAGCACGGCGCGGCGGCCGCCGGCACGCGCCTCCCCGAGCGCAGGGCTCGGGGCCTCCCCATCCCCAACGATC
AGCTTTCAGCCTATTTAAAACCAGGAGAAAAAAAAAATTAAAAAAAAAATAAGAAATAAATCACACCAGGACAAAAAAA
AAAAAAAAAACT
CitationHu N, Strobl-Mazzulla P, Sauka-Spengler T, Bronner ME. DNA methyltransferase3A as a molecular switch mediating the neural tube-to-neural crest fate transition. Genes Dev. 2012 November 1; 26(21): 2380–2385.
CopyrightCopyright © 2012 by Cold Spring Harbor Laboratory Press
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001024832.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Neural Plate/Tube
 
7-9
stage 7
stage 9
stage 9
Neural Plate/Tube
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.6002

Mouse

EmageMGI:1261827
EurexpressMGI:1261827
MGI GXDMGI:1261827

Frog

Xenbase959528

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050314-3, ZDB-GENE-050314-5
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona