GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

DNMT3B
DNA methyltransferase 3 beta

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolDNMT3B
Official Full NameDNA methyltransferase 3 beta
CGNC ID50960
also known asDNA (cytosine-5)-methyltransferase 3B|DNA (cytosine-5-)-methyltransferase 3 beta|DNA cytosine-5 methyltransferase 3 beta|DNA methyltransferase HsaIIIB
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001024828
PolypeptideNP_001019999
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.8354
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1789ENSG00000088305MIM:242860MIM:602900
Mouse13436ENSMUSG00000027478All phenotypic alleles (9):Targeted, knock-out(2) Targeted, other(7) MGI:1261819
Xenopus
Zebrafish317744, 321084, 30659ENSDARG00000036791, ENSDARG00000052402, ENSDARG00000057830ZDB-GENE-050314-1, ZDB-GENE-050314-4, ZDB-GENE-990712-11ZFIN:ZDB-GENE-050314-1, ZFIN:ZDB-GENE-050314-4, ZFIN:ZDB-GENE-990712-11
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene419287
Ensembl GeneENSGALG00000006634
KEGGgga:419287
GEISHA IdcDNMT3B.Rengaraj.2011Data SourcePublication
Complete cDNA Template Probeshow
GAACCCAGCCACCTTCCACCCGCTGTTCGAGGGGGGCCTGTGCCACACCTGCAGGGATAGATTCCTGGAGCTCTTCTAC
ATGTACGACGAAGATGGCTACCAGTCCTACTGCACCGTGTGCTGCGAGGGCAAGGAGCTGCTGCTCTGCAGCAATGCCA
GCTGCTGCAGGTGCTTCTGTGTGGAATGCCTGGAGGTCCTGGTGGGACGGGGCTCATCAGCCAAAGCAAAAGAGCAGGA
GCCCTGGAACTGCTACATGTGCCAACCCCAGAGGAGCTATGGGGTGCTGCAGCGCCGCAGGACTGGAGCTCACGTCTGC
AGGACTTCTTCACCAGTGACAAGGGGCAGGAATACGATGCACCCAAAATCTACCCAGCGGTGCCACCAGCCAAGAGGAG
ACCCATCAGAGTGCTCTCTCTGTTCGATGGCATAGCAACAGGGTACCTGGTGCTGAAGGACCTGGGCATCCAAGTGGAG
AAGTACATCGCCTCCGAGATCTGTGAGGACCCCCTGGCAGTGGGCACCGTGAGGCACGAGGGCAACATCACT
CitationRengaraj D, Lee BR, Lee SI, Seo HW, Han JY. Expression Patterns and miRNA Regulation of DNA Methyltransferases in Chicken Primordial Germ Cells. PLoS One. 2011; 6(5): e19524.
CopyrightCopyright Rengaraj et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
CommentsThe probe was amplified by PCR using the following primers: 5′-GAACCCAGCCACCTTCCACC-3′ and 5′-AGTGATGTTGCCCTCGTGCC-3′ and was extracted from NCBI Acc# NM_001024828.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
Area Opaca
Area Pellucida
EG&K stageX
4-6
stage 6
Widespread Expression
 
7-12
stage 12
stage 12
Widespread Expression
 
19-24
stage 24
Gonad
 
25-30
stage 29
stage 29
stage 29
Ovary
Testis
 
31-44
stage 35
stage 35
stage 36
stage 36
stage 38
stage 38
stage 40
stage 40
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
stage 44
Ovary
Testis
HH st 40+
HH stage 36+
HH stage 38+
HH stage 40+
Hatched 1 day
Hatched 12 weeks
Hatched 25 weeks
Hatched stage 25
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.8354

Mouse

EmageMGI:1261819
EurexpressMGI:1261819
MGI GXDMGI:1261819

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050314-1, ZDB-GENE-050314-4, ZDB-GENE-990712-11
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona