| |
MIR107
microRNA 107| Gene | | Official Symbol | MIR107 | | Official Full Name | microRNA 107 | | CGNC ID | 59117 | | also known as | MIRN107, gga-mir-107, mir-107, microRNA mir-107, mir-107 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777819 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-107 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show AGCAGCATTGTACAGGGCTATCA
| | Comments | contained in an intron of EntrezGene: PANK1, 423792, pantothenate kinase 1-like protein ENSGALG00000006431 |
MouseFrogFruit FlyZebra FinchZebrafish |
|
