| |
MIR133C
microRNA 133c| Gene | | Official Symbol | MIR133C | | Official Full Name | microRNA 133c | | CGNC ID | 59145 | | also known as | MIRN133C, gga-mir-133c, microRNA mir-133c, mir-133c | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006110 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-133c | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TTGGTCCCCTTCAACCAGCTGC
| | Comments | ubiquitous; contained in an intron of Q6IEC6_CHICK, Putative ISG12(1) protein. |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 7-10 |
 | | stage 10 |
| Ubiquitous
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
