| |
MIR146A microRNA 146a| Gene | | Official Symbol | MIR146A | | Official Full Name | microRNA 146a | | CGNC ID | 59125 | | also known as | MIRN146A, gga-mir-146a, mir-146a, microRNA mir-146a, mir-146 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-146 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGAGAACTGAATTCCATGGGTT
| | Comments | stages 15 and above, ubiquitous |
MouseFrogFruit FlyZebra FinchZebrafish
|
|