|
MIR18A microRNA 18aGene | Official Symbol | MIR18A | Official Full Name | microRNA 18a | BirdBase ID | BB-GG14378 | CGNC ID | 59219 | also known as | MIR106B, MIRN18A, gga-mir-18a, mir-18a, microRNA 106b|microRNA mir-18a, mir-18a | gene type | miscRNA |
| Genomic Map | | Sequence Information | Genomic | | RNA | | Polypeptide | NC_006088 | Sequence Clusters/ESTs | Unigene |
| Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-18a | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TAAGGTGCATCTAGTGCAGATA
| Comments | 18a and b differ by 1 base; polycistronic with mir-92, -19b, -20a, -19a and 17 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|