| |
MIR199B1
microRNA 199b-1| Gene | | Official Symbol | MIR199B1 | | Official Full Name | microRNA 199b-1 | | CGNC ID | | | also known as | MIR199-1, MIRN199-1, gga-mir-199-1, gga-mir-199b, mir-199-1, microRNA 199-1|microRNA mir-199-1, mir-199a | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | Genbank | | RNA | | | Polypeptide | | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-199a | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show CCCAGTGTTCAGACTACCTGTTC
| | Comments | mir-199a-1 located in an intron of novel protein coding gene ENSGALG00000023785; mir-199a-2 located in an intron of MYOC ENSGALG00000021074. |
MouseFrogFruit FlyZebra FinchZebrafish |
|
