| |
MIR215
microRNA 215| Gene | | Official Symbol | MIR215 | | Official Full Name | microRNA 215 | | CGNC ID | 59102 | | also known as | MIRN215, gga-mir-215, microRNA mir-215, mir-215 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006091 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-215 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show ATGACCTATGAATTGACAGAC
| | Comments | low level ubiquitous or no expression
ambiguous. This miR found on the antisense strand within gene isoleucine-tRNA synthetase 2, mitochondrial ENSGALG00000009566. Listed in error as in this gene in Darnell et al., 2006. |
no images MouseFrogFruit FlyZebra FinchZebrafish |
|
