| |
MIR221
microRNA 221| Gene | | Official Symbol | MIR221 | | Official Full Name | microRNA 221 | | CGNC ID | 59214 | | also known as | MIRN221, gga-mir-221, mir-221, microRNA mir-221, mir-221 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006088 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-221 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show AGCTACATTGTCTGCTGGGTTTC
| | Comments | no detectable signal through stage 14, low level ubiquitous from stage 16-25 |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 13-18 |
 | | stage 16 |
| Ubiquitous
| | 19-22 |  | | stage 22 |
| Ubiquitous
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
