| |
MIR26A1
microRNA 26a-1| Gene | | Official Symbol | MIR26A1 | | Official Full Name | microRNA 26a-1 | | CGNC ID | 60559 | | also known as | MIR26A, MIRN26A, gga-mir-26a, mir-26a, microRNA 26A|microRNA mir-26a, mir-26a | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006127 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777941 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-26a | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TTCAAGTAATCCAGGATAGGC
| | Comments | ubiquitous; found in an intron of CTDSL_CHICK, CTD small phosphatase-like protein |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 25 |
 | | stage 25 |
| Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
