| |
MIR27B
microRNA 27b| Gene | | Official Symbol | MIR27B | | Official Full Name | microRNA 27b | | CGNC ID | 59167 | | also known as | MIRN27B, gga-mir-27b, mir-27b, microRNA mir-27b, mir-27b | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NW_003778003 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-27b | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TTCACAGTGGCTAAGTTCTGC
| | Comments | no specific expression detected; Located in intron of ENSGALG00000012615 Q5ZK89_CHICK, which also contains mir-23b and mir-24 |
no images MouseFrogFruit FlyZebra FinchZebrafish |
|
