GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HIVEP3
human immunodeficiency virus type I enhancer binding protein 3

Gene
Official SymbolHIVEP3
Official Full Namehuman immunodeficiency virus type I enhancer binding protein 3
CGNC ID53294
also known astranscription factor HIVEP3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_425767
PolypeptideXP_425767
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human59269ENSG00000127124MIM:606649
Mouse16656ENSMUSG00000028634All phenotypic alleles (2):Targeted, knock-out(2) MGI:106589
Xenopus100489803, 432339482556
Zebrafish568037ENSDARG00000037154ZDB-GENE-081029-2, ZDB-GENE-100922-42ZFIN:ZDB-GENE-081029-2, ZFIN:ZDB-GENE-100922-42
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene428208
Ensembl Gene
KEGGgga:428208

Entry 1

GEISHA Idpat.pk0042.a6Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCAGCAGCAGAAAAGAGTGAAAGAGGAGGAGGTGTCAGAAGCAGAGGAGAAGTTGGAAGTGGTGAAGCCACCCAGTGCA
ATAGAGGAAGGGAAAAAGCAGGATAAAGCTCACTTTCTTACCGAAAGCCAAGGCAGGGTTGAGGTTGAAACACCACCTA
GTTTGTCCTTAGAGCAGTCGGAGCTAAAGGAAACCCCGAGTACTTTGCAACAAGCTGTGTCCCGGTCCGGTTCTCCAAG
CTTTGAGGCGCTGGAGGAGTATCAGCAGCCAGCTGGCAAGCAGCCCCTTGGCAAGGCACCTTTACAAAGCGTGAAGAAA
GAAGACTCCAAAGAGCCAGTGGAGCAGCCTCCACCAAGCCCTCCAAGCCCTGCACCTCTGTCCGAGGTCCCTTCAAGTG
CAATGAAGTCTCGAGAAGGTACGGATATGAAGAAGGTACTTCAGTTCCCCAGTCTCCACACAACCACTAATGTCAGTTG
GTGCTATTTAAACTACATAAAGCCAAATCACATCCAGCAAGTCGACCGGCGGTCTTCAGTGTATGCCAGCTGGTGTATT
AGCTTGTATAACCCCAACCTTCCGGGTATATCCACTAAAGTCGCCCTGTCCCTCCTGAGGTCCAAGCAGAAGGTGAGCA
GGGAAACCTACACCATGGCTACTGCTCCACGGCCAGAGGCAGGCAGGCTTGTCCCGTCCAGCTCCAGGAAGCCCAAAAT
GACAGAGGTAATGCAATCCTATATATTTCTCCTCATCTATTTGGATACATGGGAAGAGGGGGACGAGGGATGGGGAATT
GCTGCTGTTAGTTTAATAGGAATTTGTTCATCCTTTTCGCAGTCTGGTAAGTTCTCAGTGAG
Commentsno specific expression detected stages 4, 12, 16, 20, 23.
no images

Entry 2

GEISHA Idpgn1c.pk019.j13Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GACCCACGCGTCCGCCCACGCGTCCGCCAAAGGGAATCTGACTAAGCATATGAAGTCAAAAGCCCACAGCAAAAAATGT
CAGGAGATGGGCGTGTTGGTATCTTCACTGGTGGATCTGGAAGCCGAAGAAGGAACCAGTGAAGACCTATTCCAGGACT
CTGAGGGGCGGGAGGGATCTGAGCCTATTGAGGAACACCAGTTTTCAGACCTAGAGGAATCTGATGATGATGATGACAA
CGAGGATGATGAAGACGAGGAGGAAGAGGAGAGCCAAGATGAACCACCTTTAAAGCTGCCGGAAGCCAAACACCCCACC
CCACTGATGCACTCTTCAGGTGGCTCTCCGACTTCTCAAGAGGAAGGCACAGAAACAGCATCGTCCTTAGCCCAAGAAA
CTGCTTCCAGCAGCCAGAAAGTCGGTGAAGGCCAGCAGGGCTCCTCCTGTGGGCTGGAAACCAGGTGGTCAGCAGACAG
CAGCGACATCGCCGTGTGCCACAGCATCCTGAGTCTCCACAGACCAGCTCTGACTTCCACCGAACAATTGGCTTCTGCT
GAAAGAGAGTCTGTCACCAGGCCACCCATGTCCCTAGCCATGGAACTGTCAGCCTCAAAAGACACCTCCCCAAGGAAAA
GGTGGTCTCCGAGCCAGGACTCCAGCAGAGCTGGCGGCAGCAGCAGACCAATGCTAGCGAGAAAGCATCTGTTAACCAA
AAATGAAACTTCACCCAAACGGTTTTCACCCACCGGGGAGATGTCTCCTCTGAGGTGCCTGTCCCCAGGGAGAGGGCTG
TCCCCGTGCCCACGTGTCTCTCCCAGGAGGGAAGCATCCCCGCTGCGGTGCGC
Commentsno specific expression detected stages 4-23.
no images

Mouse

EmageMGI:106589
EurexpressMGI:106589
MGI GXDMGI:106589

Frog

Xenbase482556

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-081029-2, ZDB-GENE-100922-42
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona