GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CREB3L1
cAMP responsive element binding protein 3 like 1

Gene
Official SymbolCREB3L1
Official Full NamecAMP responsive element binding protein 3 like 1
CGNC ID63536
also known ascyclic AMP-responsive element-binding protein 3-like protein 1|cyclic AMP-responsive element-binding protein 3-like 1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003641390
PolypeptideXP_003641438
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100859610
Ensembl Gene
KEGGgga:100859610
GEISHA Idpgn1c.pk012.m19Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
AGTTTTTCCCCACAGCCCAATTCTCTCCACCCTCAGCACCTTTGCTTTGGCAGAGGTGCTTTTTTTTCCTTTTGGTTCC
CAGCTTGGGCCCTACAGTGTGGTGCTAATCAGATCAGTACTTTCCCACTTCCCATTCTACACACCCCTTGATTTGAGAG
TGAGAGAAATCCACTTCTATCACCATATTGCAGCTGTCCATCCCCAGTTCCACTTCATGCCAAATGGGATCTCCCTAAG
AACTATGAAGAAGAAAGAACTCTGCAACCTGTAGAAGGGCTACTAAAGAGCCATAATTCCCCTCACATCCTGATATCAC
TATTGGCATCCAGTAGTGTTGTGAACACCACTGAGGACATGCTGGCATCTCTGGAAACTATTACCTCTGCCAGGAAGGA
AGTAGCATGTTTGAATTAGCCAGAGTCAAAGACTGTTTTAGACCTCCTCCTTCTAAATACTGACACCAAAGGCAGCAGC
CTCTTCCCATACCACCTATCAGGGCAGACTTTCCAAGTTTGGTGCTTGAAACACTCTAACACGATGAAAAGTACCACAA
TGTAGGATAGCAAAGTCTTTGGCTGCAGCAAATGAGAACAAACCCAAGTGCAGCAGCTGTGGCTGAAGAAATAAAGATG
GGGGGAGGGAGCACAGAAGAAGGAGGGGGGAAAAAAAGAAAAAAAAACCCTTAACTACCTACCTTTGGAAAGCCTCCAG
TAGTCAGCAATCTCCATGAAGATCCCCTCACCTCCACTGCCAGCCCTTAATGAGGTC
Reverse cDNA Template Probeshow
TTCAGCCTTTCCACCAGTTTCACCCCGTGTTCAAGAACTGGAAGAACTGAGAGAATGGCCCTCACATTTTTTTTTTTTT
CCCCTTTTTTGAAAACTGCTTTTGCCCCAGAAACCATTTAGGACAAATTTGGGCACAGCTAGCTGCAATTACGCCTGTT
TGGCCAGTGAGGTGAGGAGGAAGAAGGCCTTCAGCACAGCCCTTTTCAAGGTTCACACAGGATTTGTTTCTCACCAGAT
ACCAGAGCGTTCCCGATCTTTTGCTTCCACCCCAGCACAGAGAACCACTGCGGGGTCCAAGCACACCTTCTTCCACCCC
AGCACTTCCACTGTGCATGTCCCCATGCTTCCCATTCCCACCGTTGTACAGAGACCAAGAGCAGAACTCGTTTGTACAT
AATGAACCTTATTTTGTATTATTGCGGATCCCTTAAGATATTGTATTTTGGAGACTTTCAGATCCTATTTTCAGTATTG
TATTTTATTAAGAATTAGTGGGGGCTTAGCACCTATGAACTCCTTTTTTGTTAGCAGCTCACTTTTTCCTTATACTCCA
GTAGCGGCCTTTTCCCTCCGGTTTTTTTGTTTTGTTTTGTCTTGTTTACTTTTTTTTTTCAAGCCACCTTTTTTTTTTT
TTCCATCACTTGTTTTGCATTTGTTTGGCCAAGCAAAATAAAAATAAAATAAAAAGATGCGGCTTCAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAA
Commentsno expression detected stages 4-13.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 13
stage 18
stage 18
stage 18
Arteries
Blood Islands
Blood Vessels
Forebrain
Notochord
Somites
Tail
Widespread Expression
paired structure caudal to allantois
19-24
stage 19
stage 21
stage 24
stage 24
stage 24
Allantois
Aorta
Arteries
Blood Vessels
Endocardium
Lateral Plate Mesoderm
Leg AER
Outflow Tract
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Somites
Surface Ectoderm
Wing AER
Omphalomesenteric artery
hand section

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona