GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

NANOG
Nanog homeobox

Gene
Official SymbolNANOG
Official Full NameNanog homeobox
CGNC ID59260
also known ashomeobox protein NANOG|cNanog|homeobox transcription factor Nanog
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001146142
PolypeptideNP_001139614
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.16924
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100272166
Ensembl Gene
KEGGgga:100272166

Entry 1

GEISHA IdChEST181g6Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GGCTAGCACGACAGCTTGCACGCATAAGATACCTACAGCTTCCAGAGCACCTCTGATAGTATCACACAGTTCTCGAGCT
CTCCTGTACGGCATCAGTACCAGGCCCCTTGGCATACCCTGGGGACCCAGAATGGTTATGAGACTTAGACCTAAGTATT
GTTCTTTCCCTTCCTCCTGTTTTGTCTCATGGGGTTTCTAGGGTCTTGACTCATAGATCCAATTTCTATTCCTTTCTTT
TGCCCCTCCTTCTCAATTCCTGCTTTAACTGTTGGTGGGGTCTAGCACCCTGCTATTTCAGGTTTCTTTTCTCTTTAAA
GGCATCTCTGTGCATAGCTAACCCTTTGCAAGGGTGTTCTGTGTGTAGACAGGTGAAATTGCATTTATGGAGGGGAATG
TGCAATGCCACAGTCAGGAGCAGCAGAGATGGCGAAGATCCATGTTTACTGTCCAAGACCCACTCCGCTGCCTCTTTTG
CGGATGATTCTCTGATCTTCACCATGTGTCTTGCAGCCAAAACTTAGAGAAAACTTTTAATTTCTGCAAGAAATACCCT
ATTTGTAGCCCAGAGTCTTTCCTGCTGTCTTGCCTTTTTCTGCTGTGACCTCAGTCATCTAGTAAATTCATCTGGGTCC
TTTAAATCTCTGAACTGAAAGCCT
CommentsNo specific expression detected: stages 10, 12 negative, stages 14-21 had widespread, low-level expression.
no images

Entry 2

GEISHA IdNANOG.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCAGCAGCAGACCTCTCCTTGAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGCCAAAGAAGCCCTCATCCTCCcDNA Template Length595
Forward cDNA Template Probeshow
ACGGATACGGCCCTGCCCATTCCCATAAGTCTGGCCACTGCTGTAAGCCTGGTGTCCACTGGTAACAGCCTGAAGGTTT
CTGTTGGCAACAACAGGGAAGCCCTGGTGAAATGTAGGGGTCATATCCAGATACGCAGCTTGATGAAACCCATTCTGTG
GTAGATAAATCCCTTTATCCACCCACTGACTCTCTTTCTGGCAACGTTTAAACTTCATTCGTTGGTTCTGAAACCACGT
CTTCACCTGCTTGTAGGTGAGCCCCAGAGCAGCAGCCAGCTCCCGGATCTGATGGGGGCTGAGGTACTTCTGGCTCTGA
AACCGCTGGTGCAGGGTCTGCAGCTGCTCCTGGGAGAAAGCTGTGCGGCTCTTGGCCTTCCTTGTCCCACTCTCACCTT
TATCCTTAACCTTCTGAAAAGTGGGGCGGTGAGATGGGTGGTCTGCAGTAGGGCTAGTGGCAGAGTCTGGGGTATACTG
AATGAGTGTCCCAGAGCTGGAAGAAGCTGGAGAGGCATCTGGGTGGCAGGGCGTTTTCTGCTCTGTGGTCAAGGAGAGG
TCTGCTGATGANNNACCNCCCATCTCACNNCGCCCCACTTTTCAGAGGTTAAGGATAAAGGTGAGAGTGGGACAGGAAA
GCCAAGAGCCGCACGCTTTCTCCAGGAGCGCTGCTGACCCTGCCCCACGTTTCATATCAGAAGTACTACTCCCCCATCC
AATACCGGAATTGCGAGTGTCCTTGGTTCTCTTCAACTAGGTTAAAACTAGGTTTATAACTGCTTTG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 5
stage 5
stage 6
stage 6
Area Opaca
Epiblast
Germ Cells/PGCs
Germinal Crescent
extraembryonic ectoderm
 
7-12
stage 7
stage 11
stage 12
Extraembryonic
Germ Cells/PGCs
Germinal Crescent
Neural Plate/Tube
Unlabeled
Unlabeled Embryonic
 
13-18
stage 18
Germ Cells/PGCs
Gonad
Ventral view.
19-24
stage 19
stage 21
stage 23
stage 24
Eye
Germ Cells/PGCs
Gonad
Ventral view.
25
stage 25
Eye
Germ Cells/PGCs
Gonad
 

Entry 3

GEISHA IdNanog.Cañón.2006Data SourcePublication
Forward cDNA Template Probeshow
CTTGCAGGCAGAAGATACCTACAGCTTCCAGAGCACCTCTGATAGTATCACACAGTTCTCGAGCTCTCCTGTACGGCAT
CAGTACCAGGCCCCTTGGCATACCCTGGGGACCCAGAATGGTTATGAGACTTAGACCTAAGTATGTTCTTTCCCTTCCT
CCTGTTTNGTCTCATGGGGTTTCTAGGGTCTTGACTCATAGATCCAATTTCTATTCCTTTCTTTGCCCCTCCTTCTCAA
TTCCTGCTTTAACTGTTGGTGGGGTCTAGCACCCTGCTATTTCAGGTTTCTTTTCTCTTTAAAGGCATCTCTGTGCATA
GCTAACCCTTTGCAAGGGTGTTCTGTGTGTAGACAGGTGAAATTGCATTTATGGAGGGGAATGTGCAATGCCACAGTCA
GGAGCAGCAGAGATGGCGAAGATCCATGTTTACTGTCCAAGACCCACTCCGCTGCCTCTTTTGCGGATGATTCTCTGAT
CTTCACCATGTGTCTTGCAGCCAAAACTTAGAGAAAACTTTTAATTTCTGCAAGAAATACCCTATTTGTAGCCCAGAGT
CTTTCCTGCTGTCTTGCCTTTTTCTGCTGTGACCTCAGTCATCTAGTAAATTCATCTGGGTCCTTTAAATCTCTGAACT
GAAAGCCT
CitationCañón S, Herranz C, Manzanares M. (2006) Germ cell restricted expression of chick Nanog. Dev Dyn. 2006 Oct;235(10):2889-94.
CopyrightCopyright © 2006 Wiley-Liss, Inc.
CommentsAuthors state: Clone ChEST181g6 (accession no. BU454887) was selected for generating a digoxigenin-labeled riboprobe, as further sequencing of this clone showed that it contained a 625-bp fragment that include the last residues of the coding sequence of Nanog.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
stage 3
Epiblast
 
4-6
stage 5
stage 6
Area Opaca
Area Pellucida
Germinal Crescent
 
7-12
stage 7
stage 8
stage 10
stage 10
stage 10
stage 12
stage 12
Area Opaca
Area Pellucida
Blood Vessels
Germinal Crescent
Primordial Germ Cells (PGCs), vitelline vessels
vitelline vessels, Primordial Germ Cells (PGCs)
vitelline vessels, primordial germ cells (PGCs)
19-20
stage 20
stage 20
stage 20
Gonad
primordial germ cells and genital ridges

Entry 4

GEISHA IdNanog.Lavial.2007Data SourcePublication
Complete cDNA Template Probeshow
CAGCAGACCTCTCCTTGACCACAGAGCAGAAAACGCCCTGCCACCCAGATGCCTCTCCAGCTTCTTCCAGCTCTGGGAC
ACTCATTCAGTATACCCCAGACTCTGCCACTAGCCCTACTGCAGACCACCCATCTCACCGCCCCACTTTTCAGAAGGTT
AAGGATAAAGGTGAGAGTGGGACAAGGAA
CitationLavial F, Acloque H, Bertocchini F, Macleod DJ, Boast S, Bachelard E, Montillet G, Thenot S, Sang HM, Stern CD, Samarut J, Pain B (2007). The Oct4 homologue PouV and Nanog regulate pluripotency in chicken embryonic stem cells. Development. 2007 Oct;134(19):3549-63.
CopyrightPublished by The Company of Biologists 2007
CommentsAccording to the authors, "Oligonucleotides (Proligo) were designed using Primer 3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and are listed in Table 1." The sequence below was obtained from NCBI (DQ867025) using the information provided.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XI
stage XII
stage XIV
Area Opaca
Area Pellucida
Epiblast
 
1-3
stage 3
stage 3
Area Pellucida
Epiblast
Area Pellucida Epiblast
4-6
stage 4
stage 5
stage 6
Germinal Crescent
Headfold
Neural Plate/Tube
 
7-8
stage 7
stage 8
Germinal Crescent
Neural Plate/Tube
 

Entry 5

GEISHA IdNANOG.Han.2018Data SourcePublication
Complete cDNA Template Probeshow
CAGCAGACCTCTCCTTGACCACAGAGCAGAAAACGCCCTGCCACCCAGATGCCTCTCCAGCTTCTTCCAGCTCTGGGAC
ACTCATTCAGTATACCCCAGACTCTGCCACTAGCCCTACTGCAGACCACCCATCTCACCGCCCCACTTTTCAGAAGGTT
AAGGATAAAGGTGAGAGTGGGACAAGGAAGGCCAAGAGCCGCACAGCTTTCTCCCAGGAGCAGCTGCAGACCCTGCACC
AGCGGTTTCAGAGCCAGAAGTACCTCAGCCCCCATCAGATCCGGGAGCTGGCTGCTGCTCTGGGGCTCACCTACAAGCA
GGTGAAGACGTGGTTTCAGAACCAACGAATGAAGTTTAAACGTTGCCAGAAAGAGAGTCAGTGGGTGGATAAAGGGATT
TATCTACCACAGAATGGGTTTCATCAAGCTGCGTATCTGGATATGACCCCTACATTTCACCAGGGCTTCCCTGTTGTTG
CCAACAGAAACCTTCAGGCTGTGACCAGTGCACACCAGGCTTACAGCAGTGGCCAGACTTATGGGAATGGGCAGGGCCT
GTATCCGTTCATGGCTGTGGAGGATGAGGGCTT
CitationJae Yong Han, Hyo Gun Lee, Young Sun Hwang, Hyung Chul Lee, Sang Kyung Kim, Deivendran Rengaraj. Expression of transcription factors during area pellucida formation in intrauterine chicken embryos. Int J Dev Biol. 2018;62(4-5):341-345. DOI: 10.1387/ijdb.170255jh.
CopyrightCopyright © UPV/EHU Press
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Han et al. 2018.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
stage 3
Area Pellucida
 
4-6
stage 4
stage 4
stage 4
stage 5
stage 5
stage 5
stage 6
Area Opaca
Area Pellucida
 
all
 
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.16924

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona