GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

YEATS4
YEATS domain containing 4

Gene
Official SymbolYEATS4
Official Full NameYEATS domain containing 4
CGNC ID7571
also known asGAS41, YEATS domain-containing protein 4, GAS41, YEATS4
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001079503
PolypeptideNP_001072971
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.18946
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly33973FBgn0031873
Human8089ENSG00000127337MIM:602116MIM:602116
Mouse64050ENSMUSG00000020171All phenotypic alleles (1):Targeted, knock-out(1) MGI:1927224
Xenopus448430, 398909956355
Zebrafish437025ENSDARG00000045874ZDB-GENE-040718-252ZFIN:ZDB-GENE-040718-252
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene771226
Ensembl Gene
KEGGgga:771226
GEISHA IdChEST226c24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
TCCTGAGTTCGGGCCTGACTCCGGGGGCAGGGTGAAGGGCGTCACCATCGTGAAGCCGGTAGTGTACGGGAACGTGGCG
CGGTACTTCGGGAAGAAGAGGGAGGAGGACGGGCACACGCATCAGTGGACGGTTTACGTGAAGCCCTACAGGAACGAGG
ACATGTCCGCCTACGTGAAAAAAATCCAGTTCAAGCTGCACGAGAGCTACGGGAATCCTCTCCGAGTCGTTACCAAACC
GCCGTACGAGATCACCGAAACGGGCTGGGGCGAATTTGAAATCATCATCAAGATATTTTTCATTGATCCAAACGAGCGA
CCCGTAACCCTGTATCACTTGTTGAAGCTTTTTCAGTCTGACACCAATGCAATCCTGGGAAAGAAAACTGTAGTTTCTG
AATTCTATGATGAAATGATATTTCAAGATCCTACTGCCATGATGCAGCAACTGCTAACGACATCCCGTCAGCTGACACT
TGGTGCTTACAAGCATGAAACAGAGTGTAAGTGCAAAATGAGGATACCTTCGCCGACCGTCATTCACTACTAATGTTTT
CTGTGGGATGTGATTGTACAGTGAGTTTGGCTGTGTGAAATTTGAATAGCTTGGTATTGGCAGTGATGACGTGATCGAT
GCCTTGCTTATCATGTTTGAAATGAAGTAGAATAAATGCAGCCTGCTTT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Neural Plate/Tube
 
7-12
stage 7
Neural Plate/Tube
 
19-20
stage 19
stage 20
Myotome
Paraxial Mesoderm
Widespread Expression
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.18946

Mouse

EmageMGI:1927224
EurexpressMGI:1927224
MGI GXDMGI:1927224

Frog

Xenbase956355

Fruit Fly

BDGPFBgn0031873

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040718-252
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona