|
 | SALL1 spalt like transcription factor 1 | The human orthologue of this gene is associated with the following human diseases: |
Gene | Official Symbol | SALL1 | Official Full Name | spalt like transcription factor 1 | BirdBase ID | BB-GG17140 | CGNC ID | 49323 | also known as | SAL1, Spalt, sal-like protein 1|sal-like 1|spalt 1|transcription factor Spalt, sal-like 1, csal-1, SALL1 | gene type | protein-coding |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | csal1.Sweetman.2005 | Data Source | Publication | Complete cDNA Template Probe | show TTCTGTGCTAAAGTGTTTGGGAGTGACAGTGCCTTGCAGATTCATTTACGTTCTCACACTGGCGAGAGGCCATTTAAAT GCAACATATGTGGAAACAGGTTCTCCACAAAGGGAAACTTAAAAGTCCACTTTCAGCGGCATAAAGAAAAATATCCTCA TATTCAGATGAATCCGTACCCAGTGCCAGAGCATTTGGACAATATTCCTACAAGCACGGGTATTCCTTATGGGATGTCT ATACCGCCAGAGAAGCCTGTCACGAGCTGG | Citation | Sweetman D, Smith TG, Farrell ER, Münsterberg A. Expression of csal1 in pre limb-bud chick embryos. Int J Dev Biol. 2005;49(4):427-30. | Copyright | "Reprinted from Int. J. Dev. Biol., 49, Sweetman D, Smith TG, Farrell ER, Münsterberg A, Expression of csal1 in pre limb-bud chick embryos, 427-30, Copyright (2005), with permission from Copyright © 2005 UBC Press". All rights reserved. | Comments | The EMBL/GenBank accession number of csal1 given in the paper is: AF288697.
According to the authors referenced: Primer sequences used to isolate the probe template corresponded to the following amino acid residues: FCAKVFG
(5'-TTYTGYGCIAARGTITTYGG-3') and EKPVTTW (antisense,
5'-CCAIGTIGTIACIGGYTTYTC-3'). |
| Data from NCBI Unigene EST Profile Unigene ID: Gga.1817 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|