GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CCDC3
coiled-coil domain containing 3

Gene
Official SymbolCCDC3
Official Full Namecoiled-coil domain containing 3
CGNC ID13134
also known ascoiled-coil domain-containing protein 3
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003640333
PolypeptideXP_003640381
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene769832
Ensembl GeneENSGALG00000027168
KEGGgga:769832

Entry 1

GEISHA IdCCDC3.Anderson.2020Data SourceDirect Submission
Complete cDNA Template Probeshow
CGGGGCTTACAATTATCTGCCCTGGCAACGGGACCCCCCCTCCGGTGCCAGCTCGCAGCACAACCCGGGAGGACTCTTT
TATTCGGCTGAGATCGAGCTGCTGTGCGACCAAGCGTGGGGCAGCATGCTGGAGGTGCCCGCCGGCTCCCGACTCAACC
TCACCGGGCTCGGCTACTTCTCCTGTCACTCGCACACCGTCATGCAGGGCTACGCTTACTTCTTCTTCCTTCGCATGGA
TGAGAATTACATCCTCCTGCCGCATGGGGTGAACTTTCAGGAGGCGATTTTCCCGGACACCCAGGAGAACAGGAGGATG
TTTGCCAGCCTTTTCCAGTTTTCCAACTGCTCGCAGGCACAGCACGCCCTGAGCTTCTCCAGCGACTGGGAGATCCAAG
AAGACAATCGACTCATGTGCTCCTCGGTCCAGAAAGCCCTGTTTGAGGAGGAGGACAGAGTGAAGAAGCTGCAGCAGAA
GGTGGCAACGTTGGAGAAGCGCAAACAAACAGCTGCGAGATCGGGTGAAGAAAGTCAAGAGGTCTCTCCGGCAAGCTAG
GAAAAATACCAGGCACATGGAGTTGATGAACAGAAAGCTCAGTGAGAAACCTTGCCTCTGCAGGTGGTCAAATTCCCTA
TATTAACTCTTTTAAAGCAGGAAAAACTCACATGCTACCTACCTTAAAGTATAATGCAAGGGTAATGCAAGAGGTTCAG
GGCCAATGATAATGGGCAAATTCTGCTGTGGTAGATCAGGATCTGGCCTTACACCTGGTCTGCACTGCTTCAAACCCTG
CCCTGAACATGACTCTGAACTGCTCTAGACCCAGGGCTAATTAACAGGAAGGCCAAACGGAATGGACGGGGACGGCAGG
AACAACCCAATTAGTCACAGGGGCCCGGGGACAATACGGCCAGAAGGTCAATAACCCACGGGCACCGGCATATCC
CommentsImages provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST871g16. Above probe sequence was obtained from NCBI-GenBank: BU387925.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Dermatome
Ectoderm
Endoderm
Neural Crest
Pharynx
Widespread Expression
extraembryonic mesoderm
stage 12-
stage 12-, dorsal
stage 12-, section 25
stage 12-, section 3
stage 12-, section 41
stage 12-, section 57

Entry 2

GEISHA IdCCDC3.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CGGGGCTTACAATTATCTGCCCTGGCAACGGGACCCCCCCTCCGGTGCCAGCTCGCAGCACAACCCGGGAGGACTCTTT
TATTCGGCTGAGATCGAGCTGCTGTGCGACCAAGCGTGGGGCAGCATGCTGGAGGTGCCCGCCGGCTCCCGACTCAACC
TCACCGGGCTCGGCTACTTCTCCTGTCACTCGCACACCGTCATGCAGGGCTACGCTTACTTCTTCTTCCTTCGCATGGA
TGAGAATTACATCCTCCTGCCGCATGGGGTGAACTTTCAGGAGGCGATTTTCCCGGACACCCAGGAGAACAGGAGGATG
TTTGCCAGCCTTTTCCAGTTTTCCAACTGCTCGCAGGCACAGCACGCCCTGAGCTTCTCCAGCGACTGGGAGATCCAAG
AAGACAATCGACTCATGTGCTCCTCGGTCCAGAAAGCCCTGTTTGAGGAGGAGGACAGAGTGAAGAAGCTGCAGCAGAA
GGTGGCAACGTTGGAGAAGCGCAAACAAACAGCTGCGAGATCGGGTGAAGAAAGTCAAGAGGTCTCTCCGGCAAGCTAG
GAAAAATACCAGGCACATGGAGTTGATGAACAGAAAGCTCAGTGAGAAACCTTGCCTCTGCAGGTGGTCAAATTCCCTA
TATTAACTCTTTTAAAGCAGGAAAAACTCACATGCTACCTACCTTAAAGTATAATGCAAGGGTAATGCAAGAGGTTCAG
GGCCAATGATAATGGGCAAATTCTGCTGTGGTAGATCAGGATCTGGCCTTACACCTGGTCTGCACTGCTTCAAACCCTG
CCCTGAACATGACTCTGAACTGCTCTAGACCCAGGGCTAATTAACAGGAAGGCCAAACGGAATGGACGGGGACGGCAGG
AACAACCCAATTAGTCACAGGGGCCCGGGGACAATACGGCCAGAAGGTCAATAACCCACGGGCACCGGCATATCC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona