GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LUM
lumican

Gene
Official SymbolLUM
Official Full Namelumican
CGNC ID50614
also known aslumican|KSPG lumican|keratan sulfate proteoglycan lumican
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001276357
PolypeptideNP_001263286
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4078
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4060MIM:600616
Mouse17022ENSMUSG00000036446All phenotypic alleles (3):Targeted, knock-out(3) MGI:109347
Xenopus496415, 3794931004933
Zebrafish415149ZDB-GENE-040625-24ZFIN:ZDB-GENE-040625-24
Gene Ontology
Molecular Functioncollagen binding
Biological Processcollagen fibril organization, positive regulation of transcription from RNA polymerase II promoter, more...visual perception
Cellular Componentextracellular space, fibrillar collagen
Links to other databases
Entrez Gene417891
Ensembl GeneENSGALG00000011271
KEGGgga:417891

Entry 1

GEISHA IdLUM.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
CCTGTCACTGTTTACAGCATATATTGGTCGATACAGTCCCTTATTGCATCTGCTCTGGGAATTAAGGAAAGCAGCTTCA
AGGCAGTAAGAGACAAGACACATTGAAAAGATGACTTTAAACTCTCTACCCATCTTTCTAGTATTGATTAGTGGCATTT
TTTGCCAGTATGACTATGGTCCTGCAGATGATTATGGCTATGACCCTTTTGGGCCATCCACAGCAGTCTGTGCCCCAGA
ATGTAATTGTCCTTTAAGCTATCCCACTGCAATGTATTGTGACAATCTTAAACTGAAAACCATTCCAATTGTACCAAGT
GGAATAAAATACCTTTATCTTCGAAACAATATGATTGAGGCCATTGAAGAGAACACATTTGATAATGTAACAGACCTGC
AGTGGCTGATCCTAGATCACAATCATCTGGAAAACTCAAAAATTAAGGGAAGAGTCTTCTCTAAACTAAAGAATCTGAA
GAAACTTCACATTAACTACAACAATTTGACAGAAGCTGTTGGACCGCTCCCCAAAACTCTGGATGACCTGCAATTAAGT
CACAATAAGATCACAAAAGTCAACCCTGGTGCACTTGAGGGGCTGGTAAATCTGACTGTCATTCATCTCCAGAACAACC
AGCTGAAAACAGATTCTATTTCTGGGGCATTTAAAGGTCTGAATTCACTTTTGTATCTAGACTTAAGCTTCAATCAACT
TACAAAGCTACCAACAGGACTGCCTCACTCCTTACTCATGCTGTATTTTGACAATAACCAGATCTCCAATATTCCTGAT
GAATACTTCCAAGGTTTTAAAACTCTGCAATATTTACGTTTATCGCACAATAAATTAACAGATTCTGGAATACCAGGCA
ATGTCTTCAATATCACATCATTGGTCGAGTTGGATCTGTCTTTCAATCAGCTGAAGAGTATTCCAACTGTCAGTGAGAA
TCTTGAAAACTTCTACCTCCAAGTGAACAAAATTAACAAGTTCCCACTGAGCAGCTTCTGTAAGGTTGTTGGACCACTG
ACCTATTCCAAGATCACACATTTACGCCTGGATGGAAACAATCTCACTCGGGCTGACCTGCCAC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Blood Vessels
Dermomyotome
Extraembryonic Blood Vessels
Head Mesenchyme
Heart
Intermediate Mesoderm
Lateral Plate Mesoderm
Pharynx
Sclerotome
Somites
Splanchnic Mesoderm
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
 

Entry 2

GEISHA IdLUM.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GGCTGTCACTGTTTACAGCATATATTGGTCGATACAGTCCCTTATTGCATCTGCTCTGGGAATTAAGGAAAGCAGCTTC
AAGGCAGTAAGAGACAAGACACATTGAAAAGATGACTTTAAACTCTCTACCCATCTTTCTAGTATTGATTAGTGGCATT
TTTTGCCAGTATGACTATGGTCCTGCAGATGATTATGGCTATGACCCTTTTGGGCCATCCACAGCAGTCTGTGCCCCAG
AATGTAATTGTCCTTTAAGCTATCCCACTGCAATGTATTGTGACAATCTTAAACTGAAAACCATTCCAATTGTACCAAG
TGGAATAAAATACCTTTATCTTCGAAACAATATGATTGAGGCCATTGAAGAGAACACATTTGATAATGTAACAGACCTG
CAGTGGCTGATCCTAGATCACAATCATCTGGAAAACTCAAAAATTAAGGGAAGAGTCTTCTCTAAACTAAAGAATCTGA
AGAAACTTCACATTAACTACAACAATTTGACAGAAGCTGTTGGACCGCTCCCCAAAACTCTGGATGACCTGCAATTAAG
TCACAATAAGATCACAAAAGTCAACCCTGGTGCCCCTTGAGGGGCTGGTAAATCTGACTGTCATTCATCTCCAGAACAA
CCAGCTGAAAACAGATTCTATTTCTGGGGCATTTAAAGGTCTGAATTCACTTTGTATCTAGACTTAAGCTTCAATCAAC
TTACAAAGCTACCAACAGGACTGCCTCACTCCTTACTCATGCTGTATTTTGACAATAACCAGATCTCCCAATATTCCTG
ATGAATACTTACCANGGTTTTANAACTCTGCAATATTTACGTTATCGCACAATAAATTAACCGAATCTGGAATACCAGG
CAATGGCTTCCATATCC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4078

Mouse

EmageMGI:109347
EurexpressMGI:109347
MGI GXDMGI:109347

Frog

Xenbase1004933

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040625-24
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona