|
FABP2 fatty acid binding protein 2Gene | Official Symbol | FABP2 | Official Full Name | fatty acid binding protein 2 | CGNC ID | 9084 | also known as | FABP, fatty acid-binding protein, intestinal|fatty acid binding protein 2, intestinal|intestinal fatty acid-binding protein, cIFABP, fatty acid binding protein 2, intestinal | gene type | protein-coding |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | cIFABP.Hiramatsu.2004 | Data Source | Publication | Complete cDNA Template Probe | show ATGGCATTTAACGGTACTTGGAAAATAGAGAAAAATGAGAACTATGAAAAATTCATGGAAGCAATGGGCGTGAATGTGA TGAAAAGAAAGTTAGGAGCCCACGATAATCTGAAGCTCACTATTCAGCAAGATGGAAACAAATTTCTTGTCAAGGAATC AAGCAACTTCCGTACCATCGACATCGAATTCACTCTGGGAGTCAGCTTTGAATACAGTCTGGCTGACGGGACTGAACTT TCAGGCTCTTGGAACCTGGAAGGAAATAAACTCGTAGGAACGTTTACTAGAAAAGATAATGGAAAAGTACTCACAGCAT ACAGAGAAATTGTAGGCAGTGAACTCATACAGACCTACGTGTACGAAGGAGTTGAAGCCAAGAGAATCTTCAAAAAGGA GTAA | Citation | Hiramatsu H, Yasugi S. Molecular analysis of the determination of developmental fate in the small intestinal epithelium in the chicken embryo. Int J Dev Biol. 2004 Dec;48(10):1141-8. | Copyright | "Reprinted from Int. J. Dev. Biol., 48,Hiramatsu H, Yasugi S , Molecular analysis of the determination of developmental fate in the small intestinal epithelium in the chicken embryo, 1141-8, Copyright (2004), with permission from Copyright © 2004 UBC Press". All rights reserved. | Comments | According to authors, "Digoxygenin-labeled RNA probes for in situ hybridization were prepared
from cDNA clones of ...chicken IFABP ( cIFABP, MRC Geneservice, Cambridge)." As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_001007923). |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 4-6 |
| stage 5 | | Unlabeled
| 7-12 | | stage 7 | | stage 9 | | stage 12 | | Midgut
|
| Data from NCBI Unigene EST Profile Unigene ID: Gga.6516 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|