GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MSI2
musashi RNA binding protein 2

Gene
Official SymbolMSI2
Official Full Namemusashi RNA binding protein 2
CGNC ID4146
also known asRNA-binding protein Musashi homolog 2|musashi homolog 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_415912
PolypeptideXP_415912
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly39919FBgn0260943
Human124540ENSG00000153944MIM:607897
Mouse76626ENSMUSG00000069769All phenotypic alleles (2):Targeted, other(1) Gene trapped(1) MGI:1923876
Xenopus100038158, 399260488851
Zebrafish394084, 100002680ENSDARG00000032614, ENSDARG00000033901ZDB-GENE-040426-1268, ZDB-GENE-030826-25ZFIN:ZDB-GENE-040426-1268, ZFIN:ZDB-GENE-030826-25
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene417667
Ensembl Gene
KEGGgga:417667
GEISHA IdMSI2.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
GAGGACGCCATGCTTATGTTTGACAAGACGACCAACAGGCATAGAGGATTTGGCTTCGTTACTTTTGAAAACGAAGACG
TGGTGGAAAAAGTCTGCGAAATCCACTTCCACGAAATCAATAACAAGATGGTAGAATGTAAGAAAGCACAACCTAAAGA
AGTGATGTTTCCACCAGGGACGAGAGGAAGGGCGCGCGGATTGCCGTACACCATGGACGCTTTTATGCTGGGGATGGGA
ATGTTGGGTTACCCGAATTTTGTCGCGACGTATGGCCGAGGTTATCCTGGATTTGCCCCAAGTTACAGCTATCAGTTTC
CAGGTTTTCCGGCAGCAGCCTACGGACCAGTAGCAGCGGCAGCCGTGGCGGCAGCAAGAGGATCAGTCTTGAATAGCTA
CAGTGCTCAACCGAATTTTGGCGCACCCGCTTCCCCGGCAGGCTCCAACCCAGCCCGGCCCGGAGGCTTCCCTGGGGCC
AACAGCCCTGGGCCCGTCGCAGACCTCTACGGCACAGCCAGCCAGGACTCCGGCGTCGGCAACTACATAAGTGCTGCCA
GCCCACAGCCGGGCTCCGGCTTCAGCCACGGGATCGCCGGACCTTTGATTGCAACGGCTTTTACAAATGGATACCATTG
AAACGTTACACATGGTTGGTTGCCATCTCACTTGGAGAGTCTCTCTGGATGTCCGGGCAAAACAGGGCGAAAGTTTCTG
AGCGGTCCCACGGTGAGGGTGACCATCATCAGACTTCAGCACTACATCTTCACCAACAGCAAACGACCTGGAGGTGGCA
CTCGACGGACTCGGGCTGGTTTTAAAAAATCTCTCTCATCATTCTCATGA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST593o8. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Atria
Eye
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Crest
Neural Plate/Tube
Pharynx
Sinus Venosus
Somites
Ventricles
 
13
stage 13
stage 13
stage 13
stage 13
Atria
Dermomyotome
Ectoderm
Endoderm
Eye
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Crest
Neural Plate/Tube
Notochord
Pharynx
Sclerotome
Sinus Venosus
Somatic Mesoderm
Somites
Spinal Cord
Splanchnic Mesoderm
Ventricles
 

Mouse

EmageMGI:1923876
EurexpressMGI:1923876
MGI GXDMGI:1923876

Frog

Xenbase488851

Fruit Fly

BDGPFBgn0260943

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-1268, ZDB-GENE-030826-25
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona