GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MBNL2
muscleblind like splicing regulator 2

Gene
Official SymbolMBNL2
Official Full Namemuscleblind like splicing regulator 2
CGNC ID50852
also known asmuscleblind-like protein 2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001081700
PolypeptideNP_001075169
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3713
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10150ENSG00000139793MIM:607327
Mouse105559ENSMUSG00000022139All phenotypic alleles (3):Targeted, knock-out(1) Gene trapped(2) MGI:2145597
Xenopus780224961078
Zebrafish560384ENSDARG00000018460ZDB-GENE-030131-9582ZFIN:ZDB-GENE-030131-9582
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene418784
Ensembl GeneENSGALG00000016890
KEGGgga:418784
GEISHA IdMBNL2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCAAACGACAACACCGTAACCG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGTGAACAGCGAATCTCCCAAGGcDNA Template Length916
Forward cDNA Template Probeshow
ACTCAATTGGACATTTCCATTAGGTATAGTTATGGAGAAAAGACAACGTTTGCAAGAATTAAACTATGTTTAGAAAATC
TTCGAAACTAAATGTTACCCTTTATGTCTTGAAACATCACAGCTGGTATCAGGTAGTTAACTATTTTAGGTCGGAGTAT
AGTAAGCATACCATATTTAATATTCATATATGACATAGCAGCACTAGCTTTTTAGAGTTTGTGATTTGTCCGTAAGAAC
AAATTCTTTACTTAGCATGCAGTTTGTGGCAATTCTAGAGAGGAGGAGACAGGATAGTATGTACAGTAGCCGTGCTTGG
CCATCCGCAGGGAGGCTTCGTGGCACTCCGTCCCGTTCCTGCTGATTACTTCAGGATTATCTGANTTGCTGTGGCNGTN
GCGGCGAAGGGAACNCTTGTTGCNGGANTTGTNGCTGCAGAGACAGNGGCGGCCGTAGCGTTGTGCANCNNGGNTACTG
NCNGGATGAACGCTGCATGTTGCTGCAACTGAGCATTGAACAACAGCCTGTTGATANTGCAAGACACTGGGATTGAAAA
CGGCACTGGCACCATTGCTTTTTTCNAGTGCTTGTCTCTTTGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
  
7-12
stage 8
stage 10
stage 11
Blood Islands
Forebrain
Foregut
Hindbrain
Midbrain
Neural Plate/Tube
Notochord
Sinus Venosus
extraembryonic mesoderm
 
13-18
stage 15
stage 18
stage 18
Aorta
Eye
Myotome
Notochord
Pharyngeal Arches and Clefts
Sclerotome
Sinus Venosus
Unlabeled
 
19-24
stage 19
stage 20
stage 20
stage 20
Foregut
Liver
Notochord
Sclerotome
Unlabeled
 
25
stage 25
stage 25
stage 25
Foregut
Head Mesenchyme
Leg Mesenchyme
Lung
Myotome
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Spinal Ganglia and Nerves
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3713

Mouse

EmageMGI:2145597
EurexpressMGI:2145597
MGI GXDMGI:2145597

Frog

Xenbase961078

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-9582
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona