GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ELF1
E74 like ETS transcription factor 1

Gene
Official SymbolELF1
Official Full NameE74 like ETS transcription factor 1
CGNC ID50862
also known asETS-related transcription factor Elf-1|E74-like factor 1 (ets domain transcription factor), E74-like factor 1 , ets domain transcription factor, elf1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001006269
PolypeptideNP_001006269
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.48307
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1997ENSG00000120690MIM:189973
Mouse13709ENSMUSG00000036461All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:107180
Xenopus780315, 495059492874
Zebrafish30396ENSDARG00000020759ZDB-GENE-980526-335ZFIN:ZDB-GENE-980526-335
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene418828
Ensembl GeneENSGALG00000016947
KEGGgga:418828

Entry 1

GEISHA IdChEST596b9Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCGGCTCGAGCGGGGACGCGGCGCCGCAGGCCCCGCTGCGAGGCGGCCCGGGAGCGGCGTGAGGGGCGAGATAAACGGC
TGTCCGCGTGGGAGAAACAGCTCAGGAAAGAACTCTCCTTGGTTTCTTTGAGAAGAGAAGGACCCAGGAACGCTGATGA
TCTGAGAACTACTGAAACTGCCACTTGGTTCATTCTGTGATCCTGCCTTTCTGCCCTGCTGCACCTTGGTGACACTGTC
CGTTCTTTTCCATTTGAGAACGCTTTTCTTCTTATGTGGAGCTGAGAGCTGGGAATGCGTTATTATGGCAGCAGTTGTA
CAGCAGAATGAGCTTGTGTTTGAATTCGCCAGCAACGTCATGGAGGATGAGCAGCAGGTATGGGATGGTGGAAGAAATG
GCATTTGTACGAGTTGGTGCAAGGAATGTTAGGAAAACGTGAGGAAAAGGTGTTGTGTAAAACACAAGAAAGCAAACAC
TGAGATCATTATTGTTGCAGCAGACCTCTGCAGTTTCAAAAGCTTCCTGTTGCTTCCTGTAACTTGCACAAGCAGAGCA
GAAATTGGTTGAAATGTTGTAACTTCTGCAGAATTGCAGAGACCTCCTCTGAAGATGTTTTTCCTTTGTCACTGATTTG
TGCCAGTAGAATCCATTCGTGCTGTAAAATTCCTGGCATTCTGGTATTTGACGGTCGCTTNCAGTTTTGTGGTATGCTA
GGATAAAATCCAAGAGAAAGCAACTGTCACACTACAGGTGACTGGAAGGAGCAGTAAGTGTTTGCTCTCTGCTCTTTGA
AGATTGGTTTGCAAACTGCATTACTGTGTGTATATCAGCTATTCG
CommentsNo specific expression detected stages 4-18.
no images

Entry 2

GEISHA IdELF1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGAACAACCAAAGAAGAAAAAGGGG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGGCTGCTGGAATCTCTGCTCGGcDNA Template Length1289
Forward cDNA Template Probeshow
TTTTCCCGAGCCGAGCTAGATCTCTAATTTGTCACCGTCGTCTTCTTTTAGCACTCCTTGTACCCCAATCTGTTTAGCT
TCTGTTGCTTTAATAACTGAAGTGATCACTGTGCCAGATGGATGAGCAACCACCTGTGAACTGCTGGGTGAAAAAGTTA
CCACTGGGGTGGTGGCAGTGAAGGATGGAGACGAAGCCACGTTAGCTGTTCCATTGCATATTGTCTGCACGCTGCTGGT
GAGAACCTGCTGAACTTGTGCTGGGCTCAGCACAATCGAGGAAGGAGGTGAGACTGGCTTCTGAGACTGTAGCATGACA
TTTTCTTTAAGAACTGTCATGGGCTGTGAAGTAGGAATGGCTTGTAAAATAAATTTTTGGGGCGTTGCTGCTGAGGCTG
GATCTGTGCTGGCTATCACTGTAGTAAGAGGCACCGTCTGGAGTGTTACAGTATGAAGCTGCTGATTTCCAGGAGAAAC
AACCACTGGGACTTGGGTTGGAGTCTGTAAAGTCCTTATATTCTGAACTGAGGGATTTAATGTTTCATCTGGAACGTTA
CTGGTTACAGCCGCGTGTCCTTCTGTGAGGGTATGCAATGGCTGCATTACGTGAACTGTCCGAAAAAGCTGAGTGGGAT
GTACTGGCTGCGTAGACTGCATTGTCCTCAAAACTTCTGAAGTCAAGCCAGGTGTCTGCTGCTGTACAACTTCTACGTG
CTCCTTAAGCTTAGCAGGCTTTGAATTTCCTGTTTTTAGAACTGTGGTGGATCCTCCCTTTGTTCCTGTGTTTGCAGAC
GCTCTAGATCTGCTCGACTGGTTTCTACTGGCCACAGGAGTTGAGAGCAAACTTGAATCTGATGATTCAGTGCTAAGAC
TTGCATCTTCATCATCTATATAGACGAGATCTTTTGGCATTTCCTTTAACTGATACACTAGGCGCTGACCTTCTACTTT
AGCCAGTATTCCTCTTTGGTAATAATATCTGAAAGCTCCACCCATTGTTTCATAATTCAGTCAGGTTTGTTTTTGTGCT
TTCCCCCAACCGGACCCGGCTTGGAATCTACAATTTGAAAATGCCCTTTCCCTTTGATCCCCTGAAATACTTAGACACT
AACTTTTTCCGGACCATGCTAAAAAAACCCCAAAAAAATTGGGTTCCCTCCCCCCTGGTTTTCCTTTCCAAAATTTTTG
GCGTTTTCCGGAACATCGACAAAAGGTTGCCCTCTCCCTTTTCCCTGGGGGACAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Unlabeled
 
4-6
stage 5
Area Pellucida
Low level expression observed.
7-12
stage 7
stage 8
stage 9
stage 11
stage 12
Anterior Intestinal Portal
Area Pellucida
Blood Islands
Blood Vessels
Intermediate Mesoderm
Lateral Plate Mesoderm
Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
Widespread Expression
Stage 7+ to 8-.
13-18
stage 13
Anterior Intestinal Portal
Blood Islands
Blood Vessels
Intermediate Mesoderm
Lateral Plate Mesoderm
Mesoderm
Neural Plate/Tube
Somites
 
19-24
stage 20
stage 22
Widespread Expression
 
25
stage 25
Widespread Expression
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.48307

Mouse

EmageMGI:107180
EurexpressMGI:107180
MGI GXDMGI:107180

Frog

Xenbase492874

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-335
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona