Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
JARID2 Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol JARID2 Official Full Name jumonji and AT-rich interaction domain containing 2 CGNC ID 9637 also known as protein Jumonji|jumonji, AT rich interactive domain 2 protein|jumonji/ARID domain-containing protein 2 gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function chromatin binding , DNA binding , histone demethylase activity Biological Process multicellular organismal development , negative regulation of histone methylation , more... negative regulation of transcription, DNA-templated , positive regulation of histone H3-K9 methylation , stem cell differentiation , transcription, DNA-templated Cellular Component ESC/E(Z) complex , histone methyltransferase complex , nucleus
Links to other databases
GEISHA Id JARID2.Olivera-Martinez.2014 Data Source Publication Complete cDNA Template Probe show GCCCCGGCGCCACGGACCTGCAGGCGGAGGGAAGGGGAGAGCAAGGGCGTCGCTTTCCGTGCCGAGAAAGGGGGGGGGT
Citation Isabel Olivera-Martinez, Nick Schurch, Roman A Li, Junfang Song, Pamela A Halley, Raman M Das, Dave W Burt, Geoffrey J Barton, Kate G Storey. Major transcriptome re-organisation and abrupt changes in signalling, cell cycle and chromatin regulation at neural differentiation in vivo. Development 2014 Aug;141(16):3266-76. Epub 2014 Jul 25. DOI: 10.1242/dev.112623. Copyright Copyright © 2014. Published by The Company of Biologists Ltd. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_001012862.1).
Data from NCBI Unigene EST ProfileGga.12117
Mouse Frog Fruit Fly Zebra Finch Zebrafish
