GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HBZ
hemoglobin subunit zeta

Gene
Official SymbolHBZ
Official Full Namehemoglobin subunit zeta
CGNC ID50308
also known asHBAP, hemoglobin subunit pi|embryonic alpha-globin pi-prime|hemoglobin alpha, subunit pi|hemoglobin pi chain|hemoglobin pi' chain|hemoglobin, zeta|pi-globin, Hemoglobin subunit pi, Hemoglobin pi chain, Pi-globin
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001004374
PolypeptideNP_001004374
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4875
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human3050MIM:142310
Mouse15126All phenotypic alleles (1):Targeted, knock-out(1) MGI:96019
Xenopus448669, 734765, 394454, 3978695888072, 478140
Zebrafish561790, 572729, 100334599, 30597, 497162, 497166, 30507ENSDARG00000045142, ENSDARG00000088330, ENSDARG00000089124, ENSDARG00000089475, ENSDARG00000079078, ENSDARG00000069735, ENSDARG00000097011ZDB-GENE-101028-1, ZDB-GENE-061207-39, ZDB-GENE-980526-80, ZDB-GENE-041001-43, ZDB-GENE-081104-38, ZDB-GENE-980526-79ZFIN:ZDB-GENE-101028-1, ZFIN:ZDB-GENE-061207-39, ZFIN:ZDB-GENE-980526-80, ZFIN:ZDB-GENE-041001-43, ZFIN:ZDB-GENE-081104-38, ZFIN:ZDB-GENE-980526-79
Gene Ontology
Molecular Functionheme binding, iron ion binding, oxygen binding, oxygen transporter activity
Biological Process
Cellular Componenthemoglobin complex
Links to other databases
Entrez Gene416650
Ensembl GeneENSGALG00000023740
KEGGgga:416650

Entry 1

GEISHA IdSoares2403F05Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CANAGCAGATCGGACGAGGGGGAGCCTGAGCCAGCACTCTCCTGCACAATGGCACTGACCCAAGCTGAGAAGGCTGCCG
TGACCACCATCTGGGCAAAGGTGGCTACCCAGATTGAGTCCATTGGGCTGGAATCACTGGAGAGGCTTTTTGCCAGCTA
TCCTCAGACGAAAACCTACTTCCCTCACTTTGATGTCAGCCAAGGCTCAGTTCAGCTTCGTGGTCACGGCTCCAAGGTC
CTGAATGCCATTGGGGAAGCTGTGAAGAACATCGATGACATTAGAGGTGCTTTGGCCAAACTCAGCGAGCTGCATGCTT
ACATCCTCAGGGTGGACCCAGTGAACTTCAAGCTGCTTTCCCACTGTATCCTGTGCTCTGTGGCTGCCCGCTATCCCAG
TGATTTCACCCCAGAAGTTCATGCTGCGTGGGACAAGTTCCTGTCCAGCATTTCCTCTGTTCTGACTGAGAAATACAGA
TAAATGGCTTCCACACTGGGTTAGGGACGTGCATCCATGGCACACAACAGCTGCCAAGTTCTGGGGTATTCTTCCTATG
CAGTCCCCCCAACTCCCCTGCGCAGGGGCTCAGCCACCTGCAGACCACAATAAATAATTCAACTGTG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 8
stage 10
stage 12
Blood
Blood Islands
 
13-18
stage 13
stage 13
stage 14
stage 15
stage 17
stage 18
stage 18
Blood
Blood Islands
 

Entry 2

GEISHA IdHBZ.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GTTNACTGAAGGGAGCCTGAGCCAGCACTCTCCTGCACAATGGCACTGACCCAAGCTGAGAAGGCTGCCGTGACCACCA
TCTGGGCAAAGGTGGCTACCCAGATTGAGTCCATTGGGCTGGAATCACTGGAGAGGCTTTTTGCCAGCTATCCTCAGAC
GAAAACCTACTTCCCTCACTTTGATGTCAGCCAAGGCTCAGTTCAGCTTCGTGGTCACGGCTCCAAGGTCCTGAATGCC
ATTGGGGAAGCTGTGAAGAACATCGATGACATTAGAGGTGCTTTGGCCAAACTCAGCGAGCTGCATGCTTACATCCTCA
GGGTGGACCCAGTGAACTTCAAGCTGCTTTCCCACTGTATCCTGTGCTCTGTGGCTGCCCGCTATCCCAGTGATTTCAC
CCCAGAAGTTCATGCTGCGTGGGACAAGTTCCTGTCCAGCATTTCCTCTGTTCTGACTGAGAAATACAGATAAATGGCT
TCCACACTGGGTTAGGGACATGCATCCATGGCACACAACAGCTGCCAAGTTCTGGGGTATTCTTCCTATGCAGTCCCCC
CAACTCCCCTGCGCAGGGGCTCAGCCACCTGCAGACCACAATAAATAATTCAACTG
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST53k6. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Blood
Blood Islands
 

Entry 3

GEISHA IdHBZ.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
TTGTTCACTGAAGGGAGCCTGAGCCAGCACTCTCCTGCACAATGGCACTGACCCAAGCTGAGAAGGCTGCCGTGACCAC
CATCTGGGCAAAGGTGGCTACCCAGATTGAGTCCATTGGGCTGGAATCACTGGAGAGGCTTTTTGCCAGCTATCCTCAG
ACGAAAACCTACTTCCCTCACTTTGATGTCAGCCAAGGCTCAGTTCAGCTTCGTGGTCACGGCTCCAAGGTCCTGAATG
CCATTGGGGAAGCTGTGAAGAACATCGATGACATTAGAGGTGCTTTGGCCAAACTCAGCGAGCTGCATGCTTACATCCT
CAGGGTGGACCCAGTGAACTTCAAGCTGCTTTCCCACTGTATCCTGTGCTCTGTGGCTGCCCGCTATCCCAGTGATTTC
ACCCCAGAAGTTCATGCTGCGTGGGACAAGTTCCTGTCCAGCATTTCCTCTGTTCTGACTGAGAAATACAGATAAATGG
CTTCCACACTGGGTTAGGGACATGCATCCATGGCACACAACAGCTGCCAAGTTCTGGGGTATTCTTCCTATGCAGTCCC
CCCAACTCCCCTGCGCAGGGGCTCAGCCACCTGCAGACCACAATAAATAATTCAACTGCTAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
Proepicardium
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4875
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona