GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

FOXO3
forkhead box O3

Gene
Official SymbolFOXO3
Official Full Nameforkhead box O3
CGNC ID11389
also known asforkhead box protein O3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_001234495
PolypeptideXP_001234496
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.23423
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2309ENSG00000118689MIM:602681
Mouse56484ENSMUSG00000048756All phenotypic alleles (7):Chemically induced(1) Targeted, knock-out(3) Targeted, other(1) Gene trapped(2) MGI:1890081
Xenopus100125025, 444992945071
Zebrafish30296, 494532ENSDARG00000042904, ENSDARG00000023058ZDB-GENE-990708-6, ZDB-GENE-050116-1ZFIN:ZDB-GENE-990708-6, ZFIN:ZDB-GENE-050116-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421769
Ensembl Gene
KEGGgga:421769

Entry 1

GEISHA IdChEST558l10Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GGTCGCCCATGCAGACTATTCAGGAGAACAAGCAGGCTACCTTCTCTTCCATTTCTCATTACAACAACCAGACGCTGCA
GGATCTGCTCGCCTCGGATGCACTTAGTCACAGCGATGTCATGATGACACAGTCTGACCCGCTTATGTCCCAGGCCAGC
ACAGCTGTGTCCGCCCAGAACTCCCGCAGGAATATAATGCTCCGCAATGACCCCATGATGTCGTTTGCTGCACAGTCCA
GTCAGGGCGGCCTGGTCAATCAGAGCCTGCCCCATCACCAGCACCAGTCTCACAGCTCTCCTCTTAGCGGCAGCCGTGC
CTTGTCCAATTCCATCAGTAACATAGGCTTGAATGACTCCAACAGCTTGGGATCCAAACATCAGCAGTCTCCTGTCAAT
CAGTCTATGCAAACACTTTCTGACCCTCTCTCAGGCTCCTCTTTGTATTCCTCTAGCATGAACCTTCCGGTCATGGGAC
ACGAGAAATTCCCAAGTGACTTAGACCTGGATATTTTCAATGGGAGCTTGGAGTGTGACATGGAGTCCATCATCCGCAG
TGAACTCATGGATGCAGATGGGCTGGATTTTAACTTTGATTCCCTCATCTCAGCACAGAACGTTGTCAGTCTGAATGTG
GGGAACTTCACTGGTGCTAAACAGGCTTCATCACAGAGTTGGGTACCAGGCTGAAGGATCTTTGAGGACAGGGAAAATG
GGCAAACAGGCCCTCAAACTGACACGAGATGTAGAGAGAGAACCCTTTGCCAAATCTGCTGTCAGCAAGTGGACAGTGA
TACTGTTTACAGCTTATGACGTTTGTGAACCCTGCATTATTTTCCTAACAAAGCAGACTGTTAAAAGGCCCCTTATCTG
AGTGAAGATTCCTCCC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
Paraxial Mesoderm
 
19-20
stage 20
Eye
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Widespread Expression
 

Entry 2

GEISHA IdFOXO3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-TCGTAAAGATGCACCTCTTG-3’
Reverse cDNA Template Primer5’-ATTAACCCTCACTAAAGGCAAATCCTCAGGGTATGGTG-3’cDNA Template Length476
Complete cDNA Template Probeshow
TCGTAAAGATGCACCTCTTGGTTTCATCCCGCAGTTATGACTGTGTAAAGTCTGTGCAGTTGTGGTTGTTGTTGCCCTG
TAGCATATCAACTTTTCCAAGCAGCCAAGGGTTTATCATTCTCGTTTCTAAAAAAAAAAAGGAGACTTTTATTTTCACA
CTCAGTTGGTCTATTTGTCATCATGGGGACTAGGTGATTAAATCCACGGGAGGTAGCTGACACTCGCTGCCCATCTCCA
TATTCAAGAAGGTTGGTTGTTAGCAGACGCGAGCATGCCACAGGTCACCAGGCCTAGGCATCACTTTGCTTATCAGTCC
AACTGCAGATGCTTCTTAACAAAGTCAGTCAAGGGCTTCCCCACAAGCCTGCTGGCACACCCCAAAATGTGAGTGCACA
CCTGTCCTCTGGTGCTCCTTCCCGAGGCAGCTCTGTGGTTGCTGCCCCAACCTGGGCTTGTCACCATACCCTGAGGATT
TG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Unlabeled
 
13-18
stage 18
Ear/Otic Placode
Eye
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Midbrain
Neural Plate/Tube
Outflow Tract
Pharyngeal Arches and Clefts
Somites
Ventricles
Wing Mesenchyme
 
19-24
stage 19
stage 20
Allantois
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Midbrain
Myotome
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Widespread Expression
 
25-26
stage 25
stage 25
stage 25
stage 25
stage 26
Aorta
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Liver
Lung
Mesonephros
Midbrain
Myotome
Outflow Tract
Pharyngeal Arches and Clefts
Sclerotome
Spinal Cord
Widespread Expression
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.23423

Mouse

EmageMGI:1890081
EurexpressMGI:1890081
MGI GXDMGI:1890081

Frog

Xenbase945071

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-990708-6, ZDB-GENE-050116-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona