GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF15
kinesin family member 15

Gene
Official SymbolKIF15
Official Full Namekinesin family member 15
CGNC ID9023
also known askinesin-like protein KIF15
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418807
PolypeptideXP_418807
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.10412
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human56992ENSG00000163808
Mouse209737ENSMUSG00000036768All phenotypic alleles (2):Targeted, other(2) MGI:1098258
Xenopus100487512, 397909, 4435681005653
Zebrafish573988ENSDARG00000012073ZDB-GENE-050622-16ZFIN:ZDB-GENE-050622-16
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420708
Ensembl GeneENSGALG00000011901
KEGGgga:420708
GEISHA IdKIF15.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGCTTCAGTGTGCACAGC
Reverse cDNA Template PrimerAGCACTCAGGGACAACAGCcDNA Template Length986
Complete cDNA Template Probeshow
TGCTTCAGTGTGCACAGCAAGACATAACAGAGAAAGAAGCTTTAATCCAGGAACTCAGGGAACAGTTGGACAAAATGAC
AGAAGAACTAGAGAAGAGGAAGAGTGAATATGAATTCAAAATGAAGCAAATAGACAGCTTTTTTGTGGACTCATCTACA
GTAACATTTCCTCAGTGTCCGAAAACTCCCCCTAATTTTGATGTGAATTTGGCAAAAATCTTAGAGACTCATGAGCAAG
AAATAGCCGATAGGAGGGCTTCTGCAATCACTCTGGAGCACCTGGTACATGAACTGAATGAAGAACGAAGAGCTAAAAA
CGATGAAATTCTACGGCTGAAGGAACAATTAAATGAATTGGAGAGCTTGCGTTTGGAAATGCAGGTACTGGTGGAAAAC
AACAGGAATTTACAGAGTCAACTTACAGAAGCTCAGAAACTAAGCAAGAACAGTGATAGGAAACACACTGATGTTCAGC
AGCTCCAAGAGAAAGAGGAGGAGATTGCTGAAGAACGACTGGCAAAGAACAAAGCAATGGAGGAGATGATGAAAATCAA
AGCAGAATTAGAAGAGACCAAAAATACTCTGAGAATCAGAGAGAATACCTGTCTTGAAATGACTCTGGAGATGGAACGA
ACGAGAGCTTTGGAGCTGAAGGCGTTTCATGAAAAAGAAGAAATTAGATCAAAACTGGAAGAAACATACGAAGAGAGAG
ATAGAATTGGAAAGGAAATAGATTTGCTGAGGAAGCAAGTTGACACTCTTGCTGAGGAGAATGGGAAATTACTCGGTCA
TCAAAATGTAAACCAGAAGATTCAGTATCTTGTGAAACTGAAGAAAGATTACACTAAGCTTACTGAGGAGACTGAAAAG
CTGCGAGCTGAAAATGCCTTTTTGAAAGAAACTAAACGATGCGACCTATGTCGGCACCACGATCAGTTATAAAGGCACC
AAGCAAAAGCTTGGCTTTTGCTGTTGTCCCTGAGTGCT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Unlabeled
 
7-12
stage 8
stage 10
Forebrain
Neural Plate/Tube
extraembryonic mesoderm
 
13-18
stage 14
stage 18
Blood Islands
Ear/Otic Placode
Eye
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Lung
Midbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Somites
Spinal Cord
Ventricles
Widespread Expression
 
19
stage 19
Allantois
Foregut
Head Mesenchyme
Leg Mesenchyme
Myotome
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.10412

Mouse

EmageMGI:1098258
EurexpressMGI:1098258
MGI GXDMGI:1098258

Frog

Xenbase1005653

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050622-16
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona