GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KDM7A
lysine demethylase 7A

Gene
Official SymbolKDM7A
Official Full Namelysine demethylase 7A
CGNC ID9733
also known asJHDM1D, lysine-specific demethylase 7A|jumonji C domain containing histone demethylase 1 homolog D|lysine (K)-specific demethylase 7A
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_416344
PolypeptideXP_416344
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human80853ENSG00000006459
Mouse338523ENSMUSG00000042599All phenotypic alleles (2):Targeted, other(2) MGI:2443388
Xenopus780121, 4440055900919
Zebrafish503902, 321248ENSDARG00000018559, ENSDARG00000018111ZDB-GENE-050309-32, ZDB-GENE-030131-9829ZFIN:ZDB-GENE-050309-32, ZFIN:ZDB-GENE-030131-9829
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene418110
Ensembl GeneENSGALG00000012848
KEGGgga:418110

Entry 1

GEISHA IdKDM7A.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGAGGAGTGGGTAGCAGTG
Reverse cDNA Template PrimerTCTCCACAGCTGCCAGAAAGcDNA Template Length725
Complete cDNA Template Probeshow
TGAGGAGTGGGTAGCAGTGACTGAATAACTCAGAGAATTAAGCCTGGTATGATAACTCGTTTTGAAGGAGAACCTTTTT
TGAGAAGTCAGAAAAGGATTTGGATTTGACATAAAAACTTAATTTTCTTTTTATAGGCAGACAGAACAGTAGGAAATGA
AACATTGCAGGGGTTTTCCCATTCTCTCAAGTTCTCACGTTCCTACAACTAGGAGAAAACAGAACTATGAAAAGAAAAC
CAAAACCAAAAGATAAAAATGGAAAGACCACCCAGAAACTGTTATCTATTACCCTTCCAGCAACTTTCCCTTTTCTCCT
CCTGCTAGACTTGTTAATGAACCCTGGCTACAAGGTAGCCTTTAATGACCTCTGAGGTAGATTACCTATGCAACCTATA
ATACTCTTCATGAATCCATTCTTAAATACAATTTTGAAAGGGTTAGATGTTGAGAGTTAATACCGTTGCTTTCTGATCA
CGTGGGGGATTTGGAGGGGGCTGGGTATTATTTTTTGGTAGTTGAAGTGCTTGTGCTACCTTTAGTGGTGATATAAGAG
TAGAGTGTCATCATCACCCTTTAGAAGCTTCAGCTTTTCCTAGGCTTTACTATATGCCATAAGCTACCTTCATTCTCAA
AGCCATAAAGTTGAAGACGTTGAAAATTTTGCAGGGCTTCAGAGTCGCAGCTGGCACGAATCTTGCTGATTGCTTTCTG
GCAGCTGTGGAGA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
Widespread Expression
 
19-24
stage 22
stage 23
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Liver
Lung
Midbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Spinal Ganglia and Nerves
Widespread Expression
Wing Mesenchyme
 
25-26
stage 26
Head Mesenchyme
Widespread Expression
 

Entry 2

GEISHA IdKDM7A.Huang.2010Data SourcePublication
Complete cDNA Template Probeshow
CCACCCCCTATCAGCAACCAGGCGACAAAAGGCAAACGTCCAAAGAAAGGAATGGCAACTGCTAAACAGCGCCTTGGGA
AGATCTTGAAGCTGAACCGCAATGGCCATGCACGCTTCTTTGTTTAATGTAGCTGCTACTTCTACTACTGCTGTCTTTC
CTATACAGACGAGTATTGAGGTTGACAGAGCCTGG
CitationHuang C, Chen J, Zhang T, Zhu Q, Xiang Y, Chen CD, Jing N. The dual histone demethylase KDM7A promotes neural induction in early chick embryos. Dev Dyn. 2010 Dec;239(12):3350-7.
CopyrightDev. Dyn Copyright © 2010 John Wiley & Sons, Inc. All Rights Reserved.
CommentsThe probe for KDM7A was amplified by PCR using the following primers: 5'-CCACCCCCTATCAGCAACC-3' and 5'-CCAGGCTCTGTCAACC-TCAA TAC-3'and was extracted from NCBI acc. # XM_416344.2.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 2
stage 2
stage 3
Primitive Streak
 
4-6
stage 4
stage 6
Neural Plate/Tube
Primitive Streak
 

Mouse

Emage
EurexpressMGI:2443388
MGI GXDMGI:2443388

Frog

Xenbase5900919

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050309-32, ZDB-GENE-030131-9829
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona