GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CBX1
chromobox 1

Gene
Official SymbolCBX1
Official Full Namechromobox 1
CGNC ID49096
also known aschromobox protein homolog 1|chromobox homolog 1 (HP1 beta homolog Drosophila )
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204332
PolypeptideNP_989663
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.25863
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly31834FBgn0030082
Human10951ENSG00000108468MIM:604511
Mouse12412ENSMUSG00000018666All phenotypic alleles (3):Targeted, other(2) Gene trapped(1) MGI:105369
Xenopus549904, 4447081005973
Zebrafish415180, 326746ENSDARG00000054442, ENSDARG00000004189ZDB-GENE-040625-68, ZDB-GENE-030131-4945ZFIN:ZDB-GENE-040625-68, ZFIN:ZDB-GENE-030131-4945
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene374237
Ensembl GeneENSGALG00000000230
KEGGgga:374237
GEISHA IdCBX1Data SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGCCAAGGAAGCCAACATCAAG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGCCCAGACCGATACACCAGTAATAGCcDNA Template Length670
Complete cDNA Template Probeshow
GCCAAGGAAGCCAACATCAAGTGCCCCCAGGTGGTCATCTCGTTCTATGAGGAGAGGTTGACATGGCATTCCTACCCCT
CAGAGGACGATGACAAGAAAGAGGACAAGAACTAAACCCTGGCACCCGCCCTGGCCAGCCTTTGTATAAAGATCTGAAC
TGTGGGTTTGAGCAAGAGGGGGAGAACGCAGCTCTGCTCAGTCGGGAGCGTAGAGATGGCTGGAGAAGATGCCCTTTGA
AGAGACCAGTATGGTTTCTGTGCCCTGCAGCTGCTCCGCTGCTTTATGCAGCTTCATGCTGTGTACAGATTCAAACCAG
CCCTGCTCACTGGGGGGGAGGGAAGGGTGGGGGGTCCGGGGTGGGGGTGGGGGGGGGCGCTGTGGGATTTCCAGGCTGT
CCATTTGGCAGCTTGTGGGAGAGGAAGCAAAGCCCCTTCCATGAAGGACTGTCACTGGTGATGGGTGGGCTGGGGAAAA
GGAGTGCAGATGGATACTGCTCATTCTTCAAAGACCATCTCAGCAACCCACAGCCTTCTTCCCAATAGTGTTAACTCTG
CATTTTTACAGCGTAGCATGTGTGTAGGTTTTTTGTTTTTTTTTTTTTCCTGTTGTTGGTTTTATTTTTGTTTTGTTTT
GTTTTTATCTTTTGCTATTACTGGTGTATCGGTCTGGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Early Mesoderm
Epiblast
Primitive Streak
 
4-6
stage 4
stage 6
Area Opaca
Blood Islands
Early Mesoderm
Ectoderm
Epiblast
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Widespread Expression
extraembryonic ectoderm
extraembryonic mesoderm
 
7-12
stage 7
stage 8
stage 10
stage 10
stage 10
stage 10
stage 12
Anterior Intestinal Portal
Area Opaca
Blood Islands
Ectoderm
Endoderm
Extraembryonic Blood Vessels
Forebrain
Foregut
Head Mesenchyme
Heart
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Pharynx
Primitive Streak
Somites
Widespread Expression
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
 
13-18
stage 14
stage 16
stage 16
stage 16
stage 16
Diencephalon
Ear/Otic Placode
Eye
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Midbrain
Neural Plate/Tube
Notochord
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Somites
 
19-24
stage 22
stage 22
stage 22
stage 23
Dermomyotome
Ear/Otic Placode
Ectoderm
Eye
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Liver
Lung
Mesonephros
Midbrain
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Wing Ectoderm
Wing Mesenchyme
 
25
stage 25
stage 25
stage 25
stage 25
stage 25
Dermomyotome
Ear/Otic Placode
Eye
Forebrain
Foregut
Heart
Hindbrain
Leg Mesenchyme
Lung
Mesencephalon
Mesonephros
Nasal Placode/Nerve
Neural Crest
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.25863

Mouse

EmageMGI:105369
EurexpressMGI:105369
MGI GXDMGI:105369

Frog

Xenbase1005973

Fruit Fly

BDGPFBgn0030082

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040625-68, ZDB-GENE-030131-4945
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona