GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MLLT10
MLLT10, histone lysine methyltransferase DOT1L cofactor

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolMLLT10
Official Full NameMLLT10, histone lysine methyltransferase DOT1L cofactor
CGNC ID5995
also known asprotein AF-10|myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophil|myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10|myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10, Protein AF-10
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418610
PolypeptideXP_418610
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.53865
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human8028ENSG00000078403MIM:601626MIM:602409
Mouse17354ENSMUSG00000026743All phenotypic alleles (4):Targeted, other(4) MGI:1329038
Xenopus100036598, 4947676408099
Zebrafish492342ENSDARG00000045401ZDB-GENE-041114-176ZFIN:ZDB-GENE-041114-176
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420509
Ensembl Gene
KEGGgga:420509
GEISHA IdChEST1013a1Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GTTGGGAGCGGTAACGCGCGAGTCCCGCGGCCGCGTCGCGGGGCAAACGAACGGGACGATGGTCTCTAGCGAGCCGCTG
CTGCTGCCGGTGTCACTGGAGGGCGAGTTCTCCACTAGCATGAAGGAGATGATCGGCGGCTGCTGCGTGTGCTCCGACG
AGAGGGGCTGGGCCGAGAACCCGCTCGTCTACTGCGACGGGCACGGCTGCAATGTCGCAGTGCATCAAGCTTGCTATGG
AATTGTTCAAGTACCCACTGGACCCTGGTTCTGCAGAAAGTGTGAATCTCAGGAAAGAGCGGCCAGAGTGAGATGTGAA
TTATGCCCTCATAAGGATGGTGCTTTAAAGAGAACAGATAATGGGGGTTGGGCTCATGTGGTTTGTGCTCTGTACATTC
CCGAGGTGCAGTTTGCGAATGTCGCTACAATGGAACCTATTGTGTTGCAGTCCGTTCCTCATGATCGTTATAATAAGAC
TTGCTATATCTGTGATGAACAAGGCAGAGAAAGTAAAGCAGCCACTGGTGCATGCATGACATGTAATAAACACGGATGT
CGACAAGCTTTTCATGTAACATGTGCACAGTTTGCAGGACTTCTTTGTGAAGAAGAAGGCAATGGTGCAGATAATGTCC
AATACTGTGGCTACTGTAAATACCATTTTAGTAAGCTGAAAAAGAGCAAACGGGGATCTAATAGGTCATATGATCAAAG
TTTAAGTGATTCTTCCTCTCACTCTCANGATAAACATCCTG
CommentsNo specific expression detected stages 15-21.
no images
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.53865

Mouse

EmageMGI:1329038
EurexpressMGI:1329038
MGI GXDMGI:1329038

Frog

Xenbase6408099

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-041114-176
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona